/var/lib/mobyle/programs/rnacofold.xml is in mobyle-programs 5.1.2-1.
This file is owned by root:root, with mode 0o644.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 | <?xml version='1.0' encoding='UTF-8'?>
<!-- XML Authors: Corinne Maufrais, Nicolas Joly and Bertrand Neron, -->
<!-- 'Biological Software and Databases' Group, Institut Pasteur, Paris. -->
<!-- Distributed under LGPLv2 License. Please refer to the COPYING.LIB document. -->
<program>
<head>
<name>rnacofold</name>
<xi:include xmlns:xi="http://www.w3.org/2001/XInclude" href="Entities/ViennaRNA_package.xml"/>
<doc>
<title>RNAcofold</title>
<description>
<text lang="en">Calculate secondary structures of two RNAs with dimerization</text>
</description>
<authors>Ivo L Hofacker, Peter F Stadler, Stephan Bernhart</authors>
<reference>I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994) Fast Folding and Comparison of RNA Secondary Structures. Monatshefte f. Chemie 125: 167-188</reference>
<reference>S.H.Bernhart, Ch. Flamm, P.F. Stadler, I.L. Hofacker Partition Function and Base Pairing Probabilities of RNA Heterodimers Algorithms Mol. Biol. (2006)</reference>
<reference>D.H. Mathews, J. Sabina, M. Zuker and H. Turner "Expanded Sequence Dependence of Thermodynamic Parameters Provides Robust Prediction of RNA Secondary Structure" JMB, 288, pp 911-940, 1999</reference>
<doclink>http://www.tbi.univie.ac.at/RNA/RNAcofold.html</doclink>
<comment>
<text lang="en">RNAcofold works much like RNAfold, but allows to specify two RNA sequences wich are then allowed to form a dimer structure.
RNA sequences are read from infile in the usual format, i.e. each line of file corresponds to one sequence,
except for lines starting with ">" which contain the name of the next sequence.
To compute the hybrid structure of two molecules, the two sequences must be concatenated using the & character as separator.
RNAcofold can compute minimum free energy (mfe) structures, as well as partition function (pf) and base pairing probability matrix (using the -p switch).</text>
<text lang="en">Since dimer formation is concentration dependent, RNAcofold can be used to compute equilibrium concentrations for all five monomer and (homo/hetero)-dimer species,
given input concentrations for the monomers.</text>
<text lang="en">Output consists of the mfe structure in bracket notation as well as PostScript structure plots and "dot plot" files containing the pair probabilities,
see the RNAfold man page for details. In the dot plots a cross marks the chain break between the two concatenated sequences.</text>
</comment>
</doc>
<category>sequence:nucleic:2D_structure</category>
<category>structure:2D_structure</category>
<command>RNAcofold</command>
</head>
<parameters>
<parameter ismandatory="1" issimple="1">
<name>seq</name>
<prompt lang="en">RNA Sequence File</prompt>
<type>
<biotype>Nucleic</biotype>
<datatype>
<class>CofoldSequence</class>
<superclass>AbstractText</superclass>
</datatype>
</type>
<format>
<code proglang="perl">" < $value" </code>
<code proglang="python">" < " + str(value) </code>
</format>
<argpos>1000</argpos>
<comment>
<text lang="en">Each line of file corresponds to one sequence,
except for lines starting with ">" which contain the name of the next sequence.
To compute the hybrid structure of two molecules,
the two sequences must be concatenated using the & character as separator.</text>
</comment>
<example>
>Seq1
ACGAUCAGAGAUCAGAGCAUACGACAGCAG&ACGAAAAAAAGAGCAUACGACAGCAG
>seq2
AAAAAAAAAAAAAAAAAAAAAAAAAAA&UUUUUUUUUUUUUUUUUUUUUUUUUUUUU
</example>
</parameter>
<paragraph>
<name>control</name>
<prompt lang="en">Control options</prompt>
<argpos>2</argpos>
<parameters>
<parameter>
<name>partition_free</name>
<prompt lang="en"> Compute the partition function and free energies (-a)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -a" : ""</code>
<code proglang="python">( "" , " -a" )[ value ]</code>
</format>
<comment>
<text lang="en">Compute the partition function and free energies not only of the hetero-dimer
consisting of the two input sequences (the "AB dimer"), but also of the homodimers AA and BB
as well as A and B monomers. The output will contain the free energies for each of these species,
as well as 5 dot plots containing the conditional pair probabilities, called ABname5.ps,
AAname5.ps and so on. For later use, these dot plot files also contain the free energy of
the ensemble as a comment. Using -a automatically toggles the -p option.</text>
</comment>
</parameter>
<parameter>
<name>equilibrium</name>
<prompt lang="en">Compute the expected equilibrium concentrations of AB, AA, BB, A, B. (-c)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -c" : ""</code>
<code proglang="python">( "" , " -c" )[ value ]</code>
</format>
<comment>
<text lang="en">In addition to everything listed under the -a option,
read in initial monomer concentrations and compute the expected equilibrium
concentrations of the 5 possible species (AB, AA, BB, A, B).
Start concentrations are read from stdin (unless the -f option is used) in
[mol/l], equilibrium concentrations are given realtive to the sum of
the two inputs. An arbitrary number of initial concentrations can be
specified (one pair of concentrations per line).</text>
</comment>
</parameter>
<parameter>
<name>partition</name>
<prompt lang="en">Calculate the partition function and base pairing probability matrix (-p)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -p" : ""</code>
<code proglang="python">( "" , " -p" )[ value ]</code>
</format>
<comment>
<text lang="en">Calculate the partition function and base pairing probability
matrix in addition to the mfe structure. Default is calculation of mfe
structure only. Prints a coarse representation of the pair probabilities
in form of a pseudo bracket notation, the ensemble free energy, the frequency
of the mfe structure, and the structural diversity.
See the description of pf_fold() and mean_bp_dist() in the RNAlib documentation
for details. Note that unless you also specify -d2 or -d0, the partition function
and mfe calculations will use a slightly different energy model.
See the dis- cussion of dangling end options below.</text>
</comment>
</parameter>
<parameter>
<name>pf</name>
<prompt lang="en">Calculate the pf without pairing matrix (-p0)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -p0" : ""</code>
<code proglang="python">( "" , " -p0" )[ value ]</code>
</format>
<comment>
<text lang="en">Calculate the partition function but not the pair probabilities,
saving about 50% in runtime. Prints the ensemble free energy -kT ln(Z).</text>
</comment>
</parameter>
<parameter>
<name>temperature</name>
<prompt lang="en">Rescale energy parameters to a temperature of temp C. (-T)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<vdef>
<value>37.0</value>
</vdef>
<format>
<code proglang="perl">(defined $value and $value != $vdef)? " -T $value" : ""</code>
<code proglang="python">( "" , " -T " + str(value) )[ value is not None and value != vdef]</code>
</format>
</parameter>
<parameter>
<name>tetraloops</name>
<prompt lang="en">Do not include special stabilizing energies for certain tetraloops (-4)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -4" : ""</code>
<code proglang="python">( "" , " -4" )[ value ]</code>
</format>
</parameter>
<parameter>
<name>dangling</name>
<prompt lang="en">How to treat dangling end energies for bases adjacent to helices in free ends
and multiloops (-d)</prompt>
<type>
<datatype>
<class>Choice</class>
</datatype>
</type>
<vdef>
<value>-d1</value>
</vdef>
<vlist>
<velem>
<value>-d1</value>
<label>Only unpaired bases can participate in at most one dangling end (-d1)</label>
</velem>
<velem>
<value>-d</value>
<label>Ignores dangling ends altogether (-d)</label>
</velem>
<velem>
<value>-d2</value>
<label>The check is ignored, this is the default for partition function folding. (-d2)</label>
</velem>
</vlist>
<format>
<code proglang="perl">(defined $value and $value ne $vdef)? " $value" : ""</code>
<code proglang="python">( "" , " " + str(value) )[ value is not None and value != vdef]</code>
</format>
<comment>
<text lang="en">How to treat 'dangling end' energies for bases adjacent to helices in free ends and multiloops: Normally only unpaired bases can participate in at most one dangling end. With -d2 this check is ignored, this is the default for partition function folding (-p). -d ignores dangling ends altogether. Note that by default pf and mfe folding treat dangling ends differently, use -d2 (or -d) in addition to -p to ensure that both algorithms use the same energy model. The -d2 options is available for RNAfold, RNAeval, and RNAinverse only.</text>
</comment>
</parameter>
<parameter>
<name>scale</name>
<prompt lang="en">Use scale*mfe as an estimate for the free energy (-S)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<format>
<code proglang="perl">(defined $value)? " -S $value" : ""</code>
<code proglang="python">( "" , " -S " + str(value) )[ value is not None ]</code>
</format>
<comment>
<text lang="en">In the calculation of the pf use scale*mfe as an estimate for the ensemble
free energy (used to avoid overflows). The default is 1.07, usefull values are 1.0 to 1.2.
Occasionally needed for long sequences.</text>
</comment>
</parameter>
</parameters>
</paragraph>
<paragraph>
<name>input</name>
<prompt lang="en">Input parameters</prompt>
<argpos>2</argpos>
<parameters>
<parameter>
<name>constraints</name>
<prompt lang="en">Calculate structures subject to constraints (-C)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -C" : ""</code>
<code proglang="python">( "" , " -C" )[ value ]</code>
</format>
<comment>
<text lang="en">The programm reads first the sequence then the a string containg constraints on the structure encoded with the symbols: </text>
<text lang="en">| (the corresponding base has to be paired x (the base is unpaired)</text>
<text lang="en">< (base i is paired with a base j>i)</text>
<text lang="en">> (base i is paired with a base j<i)</text>
<text lang="en">matching brackets ( ) (base i pairs base j)</text>
<text lang="en">Pf folding ignores constraints of type '|' '<' and '>', but disallow all pairs conflicting with a constraint of type 'x' or '( )'. This is usually sufficient to enforce the constraint.</text>
</comment>
<example>
>Seq1
ACGAUCAGAGAUCAGAGCAUACGACAGCAG&ACGAAAAAAAGAGCAUACGACAGCAG
.....................|||||||||||||||xxxxxxxxx............
>seq2
AAAAAAAAAAAAAAAAAAAAAAAAAAA&UUUUUUUUUUUUUUUUUUUUUUUUUUUUU
|||||||||...........XXXXXXXXXXX.......|||||||||||||||||||
>seq3
GGGGGGGGGGGGGGGG&CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCUUUUUUUUUU
>>>>>>>>>>>...............<<<<<<<<<<xxxxxx...............
</example>
</parameter>
<parameter>
<name>noLP</name>
<prompt lang="en">Avoid lonely pairs (helices of length 1) (-noLP)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -noLP" : ""</code>
<code proglang="python">( "" , " -noLP" )[ value ]</code>
</format>
<comment>
<text lang="en">Produce structures without lonely pairs (helices of length 1).
For partition function folding this only disallows pairs that can only occur isolated.
Other pairs may still occasionally occur as helices of length 1.</text>
</comment>
</parameter>
<parameter>
<name>noGU</name>
<prompt lang="en">Do not allow GU pairs (-noGU)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -noGU" : ""</code>
<code proglang="python">( "" , " -noGU" )[ value ]</code>
</format>
</parameter>
<parameter>
<name>noCloseGU</name>
<prompt lang="en">Do not allow GU pairs at the end of helices (-noCloseGU)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -noCloseGU" : ""</code>
<code proglang="python">( "" , " -noCloseGU" )[ value ]</code>
</format>
</parameter>
<parameter>
<name>nsp</name>
<prompt lang="en">Non standard pairs (comma seperated list) (-nsp)</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<format>
<code proglang="perl">(defined $value)? " -nsp $value" : "" </code>
<code proglang="python">( "" , " -nsp " + str(value) )[ value is not None ]</code>
</format>
<comment>
<text lang="en">Allow other pairs in addition to the usual AU,GC,and GU pairs.
pairs is a comma seperated list of additionally allowed pairs.
If a the first character is a '-' then AB will imply that AB and BA are allowed
pairs. e.g. RNAfold -nsp -GA will allow GA and AG pairs.
Nonstandard pairs are given 0 stacking energy.</text>
</comment>
</parameter>
<parameter>
<name>parameter</name>
<prompt lang="en">Energy parameter file (-P)</prompt>
<type>
<datatype>
<class>EnergyParameterFile</class>
<superclass>AbstractText</superclass>
</datatype>
</type>
<format>
<code proglang="perl">(defined $value)? " -P $value" : ""</code>
<code proglang="python">( "" , " -P " + str(value) )[ value is not None ]</code>
</format>
<comment>
<p xmlns="http://www.w3.org/1999/xhtml">Read energy parameters from paramfile, instead of using the default parameter set.
<a target="ParamFile" href="http://www.tbi.univie.ac.at/~ivo/RNA/RNAlib/Param-Files.html">( documentation for details on the file format.)</a>
</p>
</comment>
</parameter>
<!-- core dumped on raclette
<parameter>
<name>energy</name>
<prompt lang="en">Energy parameters for the artificial ABCD... alphabet (-e)</prompt>
<type>
<datatype>
<class>Choice</class>
</datatype>
</type>
<vdef>
<value>Null</value>
</vdef>
<vlist>
<velem undef="1">
<value>Null</value>
<label>No energy for the artificial ABCD</label>
</velem>
<velem>
<value>1</value>
<label>Use energy parameters for GC pairs (1)</label>
</velem>
<velem>
<value>2</value>
<label>Use energy parameters for AU pairs (2)</label>
</velem>
</vlist>
<format>
<code proglang="perl">($value)? " -e $value" : ""</code>
<code proglang="python">( "" , " -e " + str(value) )[ value is not None and value!=vdef]</code>
</format>
</parameter>
-->
</parameters>
</paragraph>
<!--
<parameter ishidden="1">
<name>readseq</name>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<format>
<code proglang="perl">"<xi:include xmlns:xi="http://www.w3.org/2001/XInclude" href="../../Local/Services/Programs/Env/ViennaRNA_readseq.xml" xpointer="xpointer(/readseq_path/text())" ><xi:fallback/></xi:include>readseq -f=19 -a $seq > $seq.tmp && (cp $seq $seq.orig && mv $seq.tmp $seq) ; "</code>
<code proglang="python">"<xi:include xmlns:xi="http://www.w3.org/2001/XInclude" href="../../Local/Services/Programs/Env/ViennaRNA_readseq.xml" xpointer="xpointer(/readseq_path/text())"><xi:fallback/></xi:include>readseq -f=19 -a "+ str(seq) + " > "+ str(seq) +".tmp && (cp "+ str(seq) +" "+ str(seq) +".orig && mv "+ str(seq) +".tmp "+ str(seq) +") ; "</code>
</format>
<argpos>-10</argpos>
</parameter>
-->
<paragraph>
<name>output_options</name>
<prompt lang="en">Output options</prompt>
<parameters>
<parameter>
<name>no_ps</name>
<prompt lang="en">Do not produce postscript drawing of the mfe structure.</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="perl">($value)? " -noPS ": ""</code>
<code proglang="python">( "" , " -noPS ")[ value ]</code>
</format>
</parameter>
<parameter isout="1">
<name>psfiles</name>
<prompt lang="en">Poscript output file</prompt>
<type>
<datatype>
<class>PostScript</class>
<superclass>Binary</superclass>
</datatype>
</type>
<filenames>
<code proglang="perl">"*.ps"</code>
<code proglang="python">"*.ps"</code>
</filenames>
</parameter>
</parameters>
</paragraph>
</parameters>
</program>
|