/usr/lib/python2.7/dist-packages/pyfaidx-0.4.8.1.egg-info/PKG-INFO is in python-pyfaidx 0.4.8.1-1.
This file is owned by root:root, with mode 0o644.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 | Metadata-Version: 1.1
Name: pyfaidx
Version: 0.4.8.1
Summary: pyfaidx: efficient pythonic random access to fasta subsequences
Home-page: http://mattshirley.com
Author: Matthew Shirley
Author-email: mdshw5@gmail.com
License: BSD
Description: |Travis| |PyPI| |Landscape| |Coverage| |Depsy| |Appveyor| |Flattr|
Description
-----------
Samtools provides a function "faidx" (FAsta InDeX), which creates a
small flat index file ".fai" allowing for fast random access to any
subsequence in the indexed FASTA file, while loading a minimal amount of the
file in to memory. This python module implements pure Python classes for
indexing, retrieval, and in-place modification of FASTA files using a samtools
compatible index. The pyfaidx module is API compatible with the `pygr`_ seqdb module.
A command-line script "`faidx`_" is installed alongside the pyfaidx module, and
facilitates complex manipulation of FASTA files without any programming knowledge.
.. _`pygr`: https://github.com/cjlee112/pygr
If you use pyfaidx in your publication, please cite:
`Shirley MD`_, `Ma Z`_, `Pedersen B`_, `Wheelan S`_. `Efficient "pythonic" access to FASTA files using pyfaidx <https://dx.doi.org/10.7287/peerj.preprints.970v1>`_. PeerJ PrePrints 3:e1196. 2015.
.. _`Shirley MD`: http://github.com/mdshw5
.. _`Ma Z`: http://github.com/azalea
.. _`Pedersen B`: http://github.com/brentp
.. _`Wheelan S`: http://github.com/swheelan
Installation
------------
This package is tested under Linux, MacOS, and Windows using Python 3.2-3.4, 2.7, 2.6, and pypy and is available from the PyPI:
::
pip install pyfaidx # add --user if you don't have root
or download a `release <https://github.com/mdshw5/pyfaidx/releases>`_ and:
::
python setup.py install
Usage
-----
.. code:: python
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> genes
Fasta("tests/data/genes.fasta") # set strict_bounds=True for bounds checking
Acts like a dictionary.
.. code:: python
>>> genes.keys() ('AB821309.1', 'KF435150.1', 'KF435149.1', 'NR_104216.1', 'NR_104215.1', 'NR_104212.1', 'NM_001282545.1', 'NM_001282543.1', 'NM_000465.3', 'NM_001282549.1', 'NM_001282548.1', 'XM_005249645.1', 'XM_005249644.1', 'XM_005249643.1', 'XM_005249642.1', 'XM_005265508.1', 'XM_005265507.1', 'XR_241081.1', 'XR_241080.1', 'XR_241079.1')
>>> genes['NM_001282543.1'][200:230]
>NM_001282543.1:201-230
CTCGTTCCGCGCCCGCCATGGAACCGGATG
>>> genes['NM_001282543.1'][200:230].seq
'CTCGTTCCGCGCCCGCCATGGAACCGGATG'
>>> genes['NM_001282543.1'][200:230].name
'NM_001282543.1'
# Start attributes are 1-based
>>> genes['NM_001282543.1'][200:230].start
201
# End attributes are 0-based
>>> genes['NM_001282543.1'][200:230].end
230
>>> genes['NM_001282543.1'][200:230].longname
'NM_001282543.1:201-230'
>>> len(genes['NM_001282543.1'])
5466
Note that start and end coordinates of Sequence objects are [1, 0]. This can be changed to [0, 0] by passing ``one_based_attributes=False`` to ``Fasta`` or ``Faidx``. This argument only affects the ``Sequence .start/.end`` attributes, and has no effect on slicing coordinates.
Indexes like a list:
.. code:: python
>>> genes[0][:50]
>AB821309.1:1-50
ATGGTCAGCTGGGGTCGTTTCATCTGCCTGGTCGTGGTCACCATGGCAAC
Slices just like a string:
.. code:: python
>>> genes['NM_001282543.1'][200:230][:10]
>NM_001282543.1:201-210
CTCGTTCCGC
>>> genes['NM_001282543.1'][200:230][::-1]
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC
>>> genes['NM_001282543.1'][200:230][::3]
>NM_001282543.1:201-230
CGCCCCTACA
>>> genes['NM_001282543.1'][:]
>NM_001282543.1:1-5466
CCCCGCCCCT........
- Slicing start and end coordinates are 0-based, just like Python sequences.
Sequence can be buffered in memory using a read-ahead buffer
for fast sequential access:
.. code:: python
>>> from timeit import timeit
>>> fetch = "genes['NM_001282543.1'][200:230]"
>>> read_ahead = "import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta', read_ahead=10000)"
>>> no_read_ahead = "import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta')"
>>> string_slicing = "genes = {}; genes['NM_001282543.1'] = 'N'*10000"
>>> timeit(fetch, no_read_ahead, number=10000)
0.2204863309962093
>>> timeit(fetch, read_ahead, number=10000)
0.1121859749982832
>>> timeit(fetch, string_slicing, number=10000)
0.0033553699977346696
Read-ahead buffering can reduce runtime by 1/2 for sequential accesses to buffered regions.
Complements and reverse complements just like DNA
.. code:: python
>>> genes['NM_001282543.1'][200:230].complement
>NM_001282543.1 (complement):201-230
GAGCAAGGCGCGGGCGGTACCTTGGCCTAC
>>> genes['NM_001282543.1'][200:230].reverse
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC
>>> -genes['NM_001282543.1'][200:230]
>NM_001282543.1 (complement):230-201
CATCCGGTTCCATGGCGGGCGCGGAACGAG
Custom key functions provide cleaner access:
.. code:: python
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', key_function = lambda x: x.split('.')[0])
>>> genes.keys()
dict_keys(['NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])
>>> genes['NR_104212'][:10]
>NR_104212:1-10
CCCCGCCCCT
Filter functions (returning True) limit the index:
.. code:: python
# new in v0.3.8
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', filt_function = lambda x: x[0] == 'N')
>>> genes.keys()
dict_keys(['NR_104212', 'NM_001282543', 'NR_104216', 'NR_104215', 'NM_001282549', 'NM_000465', 'NM_001282545', 'NM_001282548'])
>>> genes['XM_005249644']
KeyError: XM_005249644 not in tests/data/genes.fasta.
Or just get a Python string:
.. code:: python
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', as_raw=True)
>>> genes
Fasta("tests/data/genes.fasta", as_raw=True)
>>> genes['NM_001282543.1'][200:230]
CTCGTTCCGCGCCCGCCATGGAACCGGATG
You can make sure that you always receive an uppercase sequence, even if your fasta file has lower case
.. code:: python
>>> from pyfaidx import Fasta
>>> reference = Fasta('tests/data/genes.fasta.lower', sequence_always_upper=True)
>>> reference['gi|557361099|gb|KF435150.1|'][1:70]
>gi|557361099|gb|KF435150.1|:2-70
TGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAAA
You can also perform line-based iteration, receiving the sequence lines as they appear in the FASTA file:
.. code:: python
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> for line in genes['NM_001282543.1']:
... print(line)
CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
CGATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGC
...
Sequence names are truncated on any whitespace. This is a limitation of the indexing strategy. However, full names can be recovered:
.. code:: python
# new in v0.3.7
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> for record in genes:
... print(record.name)
... print(record.long_name)
...
gi|563317589|dbj|AB821309.1|
gi|563317589|dbj|AB821309.1| Homo sapiens FGFR2-AHCYL1 mRNA for FGFR2-AHCYL1 fusion kinase protein, complete cds
gi|557361099|gb|KF435150.1|
gi|557361099|gb|KF435150.1| Homo sapiens MDM4 protein variant Y (MDM4) mRNA, complete cds, alternatively spliced
gi|557361097|gb|KF435149.1|
gi|557361097|gb|KF435149.1| Homo sapiens MDM4 protein variant G (MDM4) mRNA, complete cds
...
.. role:: red
If you want to modify the contents of your FASTA file in-place, you can use the `mutable` argument.
Any portion of the FastaRecord can be replaced with an equivalent-length string.
:red:`Warning`: *This will change the contents of your file immediately and permanently:*
.. code:: python
>>> genes = Fasta('tests/data/genes.fasta', mutable=True)
>>> type(genes['NM_001282543.1'])
<class 'pyfaidx.MutableFastaRecord'>
>>> genes['NM_001282543.1'][:10]
>NM_001282543.1:1-10
CCCCGCCCCT
>>> genes['NM_001282543.1'][:10] = 'NNNNNNNNNN'
>>> genes['NM_001282543.1'][:15]
>NM_001282543.1:1-15
NNNNNNNNNNCTGGC
The FastaVariant class provides a way to integrate single nucleotide variant calls to generate a consensus sequence.
.. code:: python
# new in v0.4.0
>>> consensus = FastaVariant('tests/data/chr22.fasta', 'tests/data/chr22.vcf.gz', het=True, hom=True)
RuntimeWarning: Using sample NA06984 genotypes.
>>> consensus['22'].variant_sites
(16042793, 21833121, 29153196, 29187373, 29187448, 29194610, 29821295, 29821332, 29993842, 32330460, 32352284)
>>> consensus['22'][16042790:16042800]
>22:16042791-16042800
TCGTAGGACA
>>> Fasta('tests/data/chr22.fasta')['22'][16042790:16042800]
>22:16042791-16042800
TCATAGGACA
>>> consensus = FastaVariant('tests/data/chr22.fasta', 'tests/data/chr22.vcf.gz', sample='NA06984', het=True, hom=True, call_filter='GT == "0/1"')
>>> consensus['22'].variant_sites
(16042793, 29187373, 29187448, 29194610, 29821332)
.. _faidx:
It also provides a command-line script:
cli script: faidx
~~~~~~~~~~~~~~~~~
.. code:: bash
Fetch sequences from FASTA. If no regions are specified, all entries in the
input file are returned. Input FASTA file must be consistently line-wrapped,
and line wrapping of output is based on input line lengths.
positional arguments:
fasta FASTA file
regions space separated regions of sequence to fetch e.g.
chr1:1-1000
optional arguments:
-h, --help show this help message and exit
-b BED, --bed BED bed file of regions
-o OUT, --out OUT output file name (default: stdout)
-i {bed,chromsizes,nucleotide,transposed}, --transform {bed,chromsizes,nucleotide,transposed} transform the requested regions into another format. default: None
-c, --complement complement the sequence. default: False
-r, --reverse reverse the sequence. default: False
-a SIZE_RANGE, --size-range SIZE_RANGE
selected sequences are in the size range [low, high]. example: 1,1000 default: None
-n, --no-names omit sequence names from output. default: False
-f, --full-names output full names including description. default: False
-x, --split-files write each region to a separate file (names are derived from regions)
-l, --lazy fill in --default-seq for missing ranges. default: False
-s DEFAULT_SEQ, --default-seq DEFAULT_SEQ
default base for missing positions and masking. default: N
-d DELIMITER, --delimiter DELIMITER
delimiter for splitting names to multiple values (duplicate names will be discarded). default: None
-g REGEX, --regex REGEX
selected sequences are those matching regular expression. default: .*
-v, --invert-match selected sequences are those not matching 'regions' argument. default: False
-m, --mask-with-default-seq
mask the FASTA file using --default-seq default: False
-M, --mask-by-case mask the FASTA file by changing to lowercase. default: False
--no-rebuild do not rebuild the .fai index even if it is out of date. default: False
--version print pyfaidx version number
Examples:
.. code:: bash
$ faidx tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
>NM_001282543.1:201-210
CTCGTTCCGC
>NM_001282543.1:300-320
GTAATTGTGTAAGTGACTGCA
$ faidx --full-names tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1| Homo sapiens BRCA1 associated RING domain 1 (BARD1), transcript variant 2, mRNA
CTCGTTCCGC
$ faidx --no-names tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
CTCGTTCCGC
GTAATTGTGTAAGTGACTGCA
$ faidx --complement tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1:201-210 (complement)
GAGCAAGGCG
$ faidx --reverse tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1:210-201
CGCCTTGCTC
$ faidx --reverse --complement tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1:210-201 (complement)
GCGGAACGAG
$ faidx tests/data/genes.fasta NM_001282543.1
>NM_001282543.1:1-5466
CCCCGCCCCT........
..................
..................
..................
$ faidx --regex "^NM_00128254[35]" genes.fasta
>NM_001282543.1
..................
..................
..................
>NM_001282545.1
..................
..................
..................
$ faidx --lazy tests/data/genes.fasta NM_001282543.1:5460-5480
>NM_001282543.1:5460-5480
AAAAAAANNNNNNNNNNNNNN
$ faidx --lazy --default-seq='Q' tests/data/genes.fasta NM_001282543.1:5460-5480
>NM_001282543.1:5460-5480
AAAAAAAQQQQQQQQQQQQQQ
$ faidx tests/data/genes.fasta --bed regions.bed
...
$ faidx --transform chromsizes tests/data/genes.fasta
AB821309.1 3510
KF435150.1 481
KF435149.1 642
NR_104216.1 4573
NR_104215.1 5317
NR_104212.1 5374
...
$ faidx --transform bed tests/data/genes.fasta
AB821309.1 1 3510
KF435150.1 1 481
KF435149.1 1 642
NR_104216.1 1 4573
NR_104215.1 1 5317
NR_104212.1 1 5374
...
$ faidx --transform nucleotide tests/data/genes.fasta
name start end A T C G N
AB821309.1 1 3510 955 774 837 944 0
KF435150.1 1 481 149 120 103 109 0
KF435149.1 1 642 201 163 129 149 0
NR_104216.1 1 4573 1294 1552 828 899 0
NR_104215.1 1 5317 1567 1738 968 1044 0
NR_104212.1 1 5374 1581 1756 977 1060 0
...
faidx --transform transposed tests/data/genes.fasta
AB821309.1 1 3510 ATGGTCAGCTGGGGTCGTTTCATC...
KF435150.1 1 481 ATGACATCATTTTCCACCTCTGCT...
KF435149.1 1 642 ATGACATCATTTTCCACCTCTGCT...
NR_104216.1 1 4573 CCCCGCCCCTCTGGCGGCCCGCCG...
NR_104215.1 1 5317 CCCCGCCCCTCTGGCGGCCCGCCG...
NR_104212.1 1 5374 CCCCGCCCCTCTGGCGGCCCGCCG...
...
$ faidx --split-files tests/data/genes.fasta
$ ls
AB821309.1.fasta NM_001282549.1.fasta XM_005249645.1.fasta
KF435149.1.fasta NR_104212.1.fasta XM_005265507.1.fasta
KF435150.1.fasta NR_104215.1.fasta XM_005265508.1.fasta
NM_000465.3.fasta NR_104216.1.fasta XR_241079.1.fasta
NM_001282543.1.fasta XM_005249642.1.fasta XR_241080.1.fasta
NM_001282545.1.fasta XM_005249643.1.fasta XR_241081.1.fasta
NM_001282548.1.fasta XM_005249644.1.fasta
$ faidx --delimiter='_' tests/data/genes.fasta 000465.3
>000465.3
CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
.......
$ faidx --size-range 5500,6000 -i chromsizes tests/data/genes.fasta
NM_000465.3 5523
$ faidx -m --bed regions.bed tests/data/genes.fasta
### Modifies tests/data/genes.fasta by masking regions using --default-seq character ###
$ faidx -M --bed regions.bed tests/data/genes.fasta
### Modifies tests/data/genes.fasta by masking regions using lowercase characters ###
Similar syntax as ``samtools faidx``
A lower-level Faidx class is also available:
.. code:: python
>>> from pyfaidx import Faidx
>>> fa = Faidx('genes.fa') # can return str with as_raw=True
>>> fa.index
OrderedDict([('AB821309.1', IndexRecord(rlen=3510, offset=12, lenc=70, lenb=71)), ('KF435150.1', IndexRecord(rlen=481, offset=3585, lenc=70, lenb=71)),... ])
>>> fa.index['AB821309.1'].rlen
3510
fa.fetch('AB821309.1', 1, 10) # these are 1-based genomic coordinates
>AB821309.1:1-10
ATGGTCAGCT
- If the FASTA file is not indexed, when ``Faidx`` is initialized the
``build_index`` method will automatically run, and
the index will be written to "filename.fa.fai" with ``write_fai()``.
where "filename.fa" is the original FASTA file.
- Start and end coordinates are 1-based.
Changelog
---------
Please see the `releases <https://github.com/mdshw5/pyfaidx/releases>`_ for a
comprehensive list of version changes.
Known issues
------------
I try to fix as many bugs as possible, but most of this work is supported by a single developer. Please check the `known issues <https://github.com/mdshw5/pyfaidx/issues?utf8=✓&q=is%3Aissue+is%3Aopen+label%3Aknown>`_ for bugs relevant to your work. Pull requests are welcome.
Contributing
------------
Create a new Pull Request with one feauture. If you add a new feature, please
create also the relevant test.
To get test running on your machine:
- Create a new virtualenv and install the `dev-requirements.txt`.
- Download the test data running:
python tests/data/download_gene_fasta.py
- Run the tests with
nosetests --with-coverage --cover-package=pyfaidx
Acknowledgements
----------------
This project is freely licensed by the author, `Matthew
Shirley <http://mattshirley.com>`_, and was completed under the
mentorship and financial support of Drs. `Sarah
Wheelan <http://sjwheelan.som.jhmi.edu>`_ and `Vasan
Yegnasubramanian <http://yegnalab.onc.jhmi.edu>`_ at the Sidney Kimmel
Comprehensive Cancer Center in the Department of Oncology.
.. |Travis| image:: https://travis-ci.org/mdshw5/pyfaidx.svg?branch=master
:target: https://travis-ci.org/mdshw5/pyfaidx
.. |PyPI| image:: https://img.shields.io/pypi/v/pyfaidx.svg?branch=master
:target: https://pypi.python.org/pypi/pyfaidx
.. |Landscape| image:: https://landscape.io/github/mdshw5/pyfaidx/master/landscape.svg
:target: https://landscape.io/github/mdshw5/pyfaidx/master
:alt: Code Health
.. |Coverage| image:: https://codecov.io/gh/mdshw5/pyfaidx/branch/master/graph/badge.svg
:target: https://codecov.io/gh/mdshw5/pyfaidx
.. |Depsy| image:: http://depsy.org/api/package/pypi/pyfaidx/badge.svg
:target: http://depsy.org/package/python/pyfaidx
.. |Appveyor| image:: https://ci.appveyor.com/api/projects/status/80ihlw30a003596w?svg=true
:target: https://ci.appveyor.com/project/mdshw5/pyfaidx
.. |Flattr| image:: http://button.flattr.com/flattr-badge-large.png
:target: https://flattr.com/submit/auto?fid=po00kq&url=https%3A%2F%2Fgithub.com%2Fmdshw5%2Fpyfaidx
Platform: UNKNOWN
Classifier: Development Status :: 5 - Production/Stable
Classifier: License :: OSI Approved :: BSD License
Classifier: Environment :: Console
Classifier: Intended Audience :: Science/Research
Classifier: Natural Language :: English
Classifier: Operating System :: Unix
Classifier: Programming Language :: Python :: 3.5
Classifier: Programming Language :: Python :: 3.4
Classifier: Programming Language :: Python :: 3.3
Classifier: Programming Language :: Python :: 3.2
Classifier: Programming Language :: Python :: 2.7
Classifier: Programming Language :: Python :: 2.6
Classifier: Programming Language :: Python :: Implementation :: PyPy
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Provides: p
Provides: y
Provides: f
Provides: a
Provides: i
Provides: d
Provides: x
|