/usr/share/genometools/gtdata/doc/fingerprint.lua is in genometools-common 1.5.10+ds-2.
This file is owned by root:root, with mode 0o644.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 | print ([[
If neither option '-check' nor option '-duplicates' is used, the fingerprints
for all sequences are shown on stdout.
Fingerprint of a sequence is case insensitive. Thus MD5 fingerprint of two
identical sequences will be the same even if one is soft-masked.
Examples
--------
Compute (unified) list of fingerprints:
$ gt fingerprint U89959_ests.fas | sort | uniq > U89959_ests.checklist_uniq
Compare fingerprints:
$ gt fingerprint -check U89959_ests.checklist_uniq U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33 only in sequence_file(s)
Make sure a sequence file contains no duplicates (not the case here):
$ gt fingerprint -duplicates U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33 2
gt fingerprint: error: duplicates found: 1 out of 200 (0.500%)
Extract sequence with given fingerprint:
$ gt fingerprint -extract 6d3b4b9db4531cda588528f2c69c0a57 U89959_ests.fas
>SQ;8720010
TTTTTTTTTTTTTTTTTCCTGACAAAACCCCAAGACTCAATTTAATCAATCCTCAAATTTACATGATAC
CAACGTAATGGGAGCTTAAAAATA
Return values
-------------
- 0 everything went fine ('-check': the comparison was successful;
'-duplicates': no duplicates found)
- 1 an error occurred ('-check': the comparison was not successful;
'-duplicates': duplicates found)]])
|