/var/lib/mobyle/programs/eprimer3.xml is in mobyle-programs 5.1.2-2.
This file is owned by root:root, with mode 0o644.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 | <?xml version="1.0" encoding="ISO-8859-1"?>
<!-- XML Authors: Corinne Maufrais and Nicolas Joly, -->
<!-- 'Biological Software and Databases' Group, Institut Pasteur, Paris. -->
<!-- Distributed under LGPLv2 License. Please refer to the COPYING.LIB document. -->
<program>
<head>
<name>eprimer3</name>
<package>
<name>EMBOSS</name>
<version>6.3.1</version>
<doc>
<title>EMBOSS</title>
<description>
<text lang="en">European Molecular Biology Open Software Suite</text>
</description>
<authors>Rice,P. Longden,I. and Bleasby, A.</authors>
<reference>EMBOSS: The European Molecular Biology Open Software Suite (2000) Rice,P. Longden,I. and Bleasby, A. Trends in Genetics 16, (6) pp276--277</reference>
<sourcelink>http://emboss.sourceforge.net/download</sourcelink>
<homepagelink>http://emboss.sourceforge.net</homepagelink>
</doc>
</package>
<doc>
<title>eprimer3</title>
<description>
<text lang="en">Picks PCR primers and hybridization oligos</text>
</description>
<doclink>http://bioweb2.pasteur.fr/docs/EMBOSS/eprimer3.html</doclink>
<doclink>http://emboss.sourceforge.net/docs/themes</doclink>
</doc>
<category>sequence:nucleic:primers</category>
<command>eprimer3</command>
</head>
<parameters>
<paragraph>
<name>e_input</name>
<prompt lang="en">Input section</prompt>
<parameters>
<parameter issimple="1" ismandatory="1">
<name>e_sequence</name>
<prompt lang="en">sequence option</prompt>
<type>
<biotype>DNA</biotype>
<datatype>
<class>Sequence</class>
</datatype>
<dataFormat>EMBL</dataFormat>
<dataFormat>FASTA</dataFormat>
<dataFormat>GCG</dataFormat>
<dataFormat>GENBANK</dataFormat>
<dataFormat>NBRF</dataFormat>
<dataFormat>CODATA</dataFormat>
<dataFormat>RAW</dataFormat>
<dataFormat>SWISSPROT</dataFormat>
<dataFormat>GFF</dataFormat>
<card>1,n</card>
</type>
<format>
<code proglang="python">("", " -sequence=" + str(value))[value is not None]</code>
</format>
<argpos>1</argpos>
<comment>
<text lang="en">The sequence from which to choose primers. The sequence must be presented 5' to 3'</text>
</comment>
</parameter>
<parameter>
<name>e_primer</name>
<prompt lang="en">Pick pcr primer(s)</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>1</value>
</vdef>
<format>
<code proglang="python">(" -noprimer", "")[ bool(value) ]</code>
</format>
<argpos>2</argpos>
<comment>
<text lang="en">Tell EPrimer3 to pick primer(s)</text>
</comment>
</parameter>
<parameter>
<name>e_task</name>
<prompt lang="en">Task</prompt>
<type>
<datatype>
<class>Choice</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>1</value>
</vdef>
<vlist>
<velem>
<value>1</value>
<label>Pick pcr primers</label>
</velem>
<velem>
<value>2</value>
<label>Pick forward primer only</label>
</velem>
<velem>
<value>3</value>
<label>Pick reverse primer only</label>
</velem>
<velem>
<value>4</value>
<label>No primers needed</label>
</velem>
</vlist>
<format>
<code proglang="python">("", " -task=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>3</argpos>
<comment>
<text lang="en">Tell EPrimer3 what task to perform. Legal values are 1: 'Pick PCR primers', 2: 'Pick forward primer only', 3: 'Pick reverse primer only', 4: 'No primers needed'.</text>
</comment>
</parameter>
<parameter>
<name>e_hybridprobe</name>
<prompt lang="en">Pick hybridization probe</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="python">("", " -hybridprobe")[ bool(value) ]</code>
</format>
<argpos>4</argpos>
<comment>
<text lang="en">An 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification.</text>
</comment>
</parameter>
<parameter>
<name>e_mishyblibraryfile</name>
<prompt lang="en">Primer3 internal oligo mishybridizing library file (optional)</prompt>
<type>
<datatype>
<class>Primer3Mishybridizing</class>
<superclass>AbstractText</superclass>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<format>
<code proglang="python">("", " -mishyblibraryfile=" + str(value))[value is not None]</code>
</format>
<argpos>5</argpos>
<comment>
<text lang="en">Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them.
The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then EPrimer3 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set to 12.0.)
Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that EPrimer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length.
An empty value for this parameter indicates that no library should be used.</text>
</comment>
</parameter>
<parameter>
<name>e_mispriminglibraryfile</name>
<prompt lang="en">Primer3 mispriming library file (optional)</prompt>
<type>
<datatype>
<class>Primer3Mispriming</class>
<superclass>AbstractText</superclass>
</datatype>
</type>
<format>
<code proglang="python">("", " -mispriminglibraryfile=" + str(value))[value is not None]</code>
</format>
<argpos>6</argpos>
<comment>
<text lang="en">The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified.) The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then EPrimer3 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX-MISPRIMING. (The maximum value of the weight is arbitrarily set to 100.0.)
Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that EPrimer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length.
An empty value for this parameter indicates that no repeat library should be used.</text>
</comment>
</parameter>
</parameters>
</paragraph>
<paragraph>
<name>e_additional</name>
<prompt lang="en">Additional section</prompt>
<parameters>
<paragraph>
<name>e_programsection</name>
<prompt lang="en">Program options</prompt>
<parameters>
<parameter>
<name>e_numreturn</name>
<prompt lang="en">Number of results to return (value greater than or equal to 0)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<vdef>
<value>5</value>
</vdef>
<format>
<code proglang="python">("", " -numreturn=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0 is required</text>
</message>
<code proglang="python">value >= 0</code>
</ctrl>
<argpos>7</argpos>
<comment>
<text lang="en">The maximum number of primer pairs to return. Primer pairs returned are sorted by their 'quality', in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time.</text>
</comment>
</parameter>
</parameters>
</paragraph>
<paragraph>
<name>e_seqoptsection</name>
<prompt lang="en">Sequence options</prompt>
<parameters>
<parameter>
<name>e_includedregion</name>
<prompt lang="en">Included region(s)</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<format>
<code proglang="python">("", " -includedregion=" + str(value))[value is not None]</code>
</format>
<argpos>8</argpos>
<comment>
<text lang="en">A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form
(start),(end)
where (start) is the index of the first base to consider, and (end) is the last in the primer-picking region.</text>
</comment>
</parameter>
<parameter>
<name>e_targetregion</name>
<prompt lang="en">Target region(s)</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<format>
<code proglang="python">("", " -targetregion=" + str(value))[value is not None]</code>
</format>
<argpos>9</argpos>
<comment>
<text lang="en">If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of
(start),(end)
pairs where (start) is the index of the first base of a Target, and (end) is the last
E.g. 50,51 requires primers to surround the 2 bases at positions 50 and 51.</text>
</comment>
</parameter>
<parameter>
<name>e_excludedregion</name>
<prompt lang="en">Excluded region(s)</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<format>
<code proglang="python">("", " -excludedregion=" + str(value))[value is not None]</code>
</format>
<argpos>10</argpos>
<comment>
<text lang="en">Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of
(start),(end)
pairs where (start) is the index of the first base of the excluded region, and and (end) is the last. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs.
E.g. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68.</text>
</comment>
</parameter>
<parameter>
<name>e_forwardinput</name>
<prompt lang="en">Forward input primer sequence to check</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<format>
<code proglang="python">("", " -forwardinput=" + str(value))[value is not None]</code>
</format>
<argpos>11</argpos>
<comment>
<text lang="en">The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos. Must be a substring of SEQUENCE.</text>
</comment>
</parameter>
<parameter>
<name>e_reverseinput</name>
<prompt lang="en">Reverse input primer sequence to check</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<format>
<code proglang="python">("", " -reverseinput=" + str(value))[value is not None]</code>
</format>
<argpos>12</argpos>
<comment>
<text lang="en">The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE.</text>
</comment>
</parameter>
</parameters>
</paragraph>
<paragraph>
<name>e_primersection</name>
<prompt lang="en">Primer options</prompt>
<parameters>
<parameter>
<name>e_gcclamp</name>
<prompt lang="en">Gc clamp (value greater than or equal to 0)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="python">("", " -gcclamp=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0 is required</text>
</message>
<code proglang="python">value >= 0</code>
</ctrl>
<argpos>13</argpos>
<comment>
<text lang="en">Require the specified number of consecutive Gs and Cs at the 3' end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.)</text>
</comment>
</parameter>
<parameter>
<name>e_osize</name>
<prompt lang="en">Primer optimum size (value greater than or equal to 0)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>20</value>
</vdef>
<format>
<code proglang="python">("", " -osize=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0 is required</text>
</message>
<code proglang="python">value >= 0</code>
</ctrl>
<argpos>14</argpos>
<comment>
<text lang="en">Optimum length (in bases) of a primer oligo. EPrimer3 will attempt to pick primers close to this length.</text>
</comment>
</parameter>
<parameter>
<name>e_minsize</name>
<prompt lang="en">Primer minimum size (value greater than or equal to 1)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>18</value>
</vdef>
<format>
<code proglang="python">("", " -minsize=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 1 is required</text>
</message>
<code proglang="python">value >= 1</code>
</ctrl>
<argpos>15</argpos>
<comment>
<text lang="en">Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX-SIZE.</text>
</comment>
</parameter>
<parameter>
<name>e_maxsize</name>
<prompt lang="en">Primer maximum size (value less than or equal to 35)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>27</value>
</vdef>
<format>
<code proglang="python">("", " -maxsize=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value less than or equal to 35 is required</text>
</message>
<code proglang="python">value <= 35</code>
</ctrl>
<argpos>16</argpos>
<comment>
<text lang="en">Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which EPrimer3's melting-temperature is valid.</text>
</comment>
</parameter>
<parameter>
<name>e_otm</name>
<prompt lang="en">Primer optimum tm</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>60.0</value>
</vdef>
<format>
<code proglang="python">("", " -otm=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>17</argpos>
<comment>
<text lang="en">Optimum melting temperature(Celsius) for a primer oligo. EPrimer3 will try to pick primers with melting temperatures are close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.</text>
</comment>
</parameter>
<parameter>
<name>e_mintm</name>
<prompt lang="en">Primer minimum tm</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>57.0</value>
</vdef>
<format>
<code proglang="python">("", " -mintm=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>18</argpos>
<comment>
<text lang="en">Minimum acceptable melting temperature(Celsius) for a primer oligo.</text>
</comment>
</parameter>
<parameter>
<name>e_maxtm</name>
<prompt lang="en">Primer maximum tm</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>63.0</value>
</vdef>
<format>
<code proglang="python">("", " -maxtm=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>19</argpos>
<comment>
<text lang="en">Maximum acceptable melting temperature(Celsius) for a primer oligo.</text>
</comment>
</parameter>
<parameter>
<name>e_maxdifftm</name>
<prompt lang="en">Maximum difference in tm of primers</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>100.0</value>
</vdef>
<format>
<code proglang="python">("", " -maxdifftm=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>20</argpos>
<comment>
<text lang="en">Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers.</text>
</comment>
</parameter>
<parameter>
<name>e_ogcpercent</name>
<prompt lang="en">Primer optimum gc percent</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>50.0</value>
</vdef>
<format>
<code proglang="python">("", " -ogcpercent=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>21</argpos>
<comment>
<text lang="en">Primer optimum GC percent.</text>
</comment>
</parameter>
<parameter>
<name>e_mingc</name>
<prompt lang="en">Primer minimum gc percent</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>20.0</value>
</vdef>
<format>
<code proglang="python">("", " -mingc=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>22</argpos>
<comment>
<text lang="en">Minimum allowable percentage of Gs and Cs in any primer.</text>
</comment>
</parameter>
<parameter>
<name>e_maxgc</name>
<prompt lang="en">Primer maximum gc percent</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>80.0</value>
</vdef>
<format>
<code proglang="python">("", " -maxgc=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>23</argpos>
<comment>
<text lang="en">Maximum allowable percentage of Gs and Cs in any primer generated by Primer.</text>
</comment>
</parameter>
<parameter>
<name>e_saltconc</name>
<prompt lang="en">Salt concentration (mm)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>50.0</value>
</vdef>
<format>
<code proglang="python">("", " -saltconc=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>24</argpos>
<comment>
<text lang="en">The millimolar concentration of salt (usually KCl) in the PCR. EPrimer3 uses this argument to calculate oligo melting temperatures.</text>
</comment>
</parameter>
<parameter>
<name>e_dnaconc</name>
<prompt lang="en">Dna concentration (nm)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>50.0</value>
</vdef>
<format>
<code proglang="python">("", " -dnaconc=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>25</argpos>
<comment>
<text lang="en">The nanomolar concentration of annealing oligos in the PCR. EPrimer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 21) where a suitable value (for a lower initial concentration of template) is 'empirically determined'. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures.
See ADVICE FOR PICKING PRIMERS.</text>
</comment>
</parameter>
<parameter>
<name>e_maxpolyx</name>
<prompt lang="en">Maximum polynucleotide repeat (value greater than or equal to 0)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>5</value>
</vdef>
<format>
<code proglang="python">("", " -maxpolyx=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0 is required</text>
</message>
<code proglang="python">value >= 0</code>
</ctrl>
<argpos>26</argpos>
<comment>
<text lang="en">The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA.</text>
</comment>
</parameter>
</parameters>
</paragraph>
<paragraph>
<name>e_productsection</name>
<prompt lang="en">Product options</prompt>
<parameters>
<parameter>
<name>e_psizeopt</name>
<prompt lang="en">Product optimum size (value greater than or equal to 0)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>200</value>
</vdef>
<format>
<code proglang="python">("", " -psizeopt=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0 is required</text>
</message>
<code proglang="python">value >= 0</code>
</ctrl>
<argpos>27</argpos>
<comment>
<text lang="en">The optimum size for the PCR product. 0 indicates that there is no optimum product size.</text>
</comment>
</parameter>
<parameter>
<name>e_prange</name>
<prompt lang="en">Product size range</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>100-300</value>
</vdef>
<format>
<code proglang="python">("", " -prange=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>28</argpos>
<comment>
<text lang="en">The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form
(x)-(y)
where an (x)-(y) pair is a legal range of lengths for the product. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100-150. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100-150 200-250.
EPrimer3 favors ranges to the left side of the parameter string. EPrimer3 will return legal primers pairs in the first range regardless the value of the objective function for these pairs. Only if there are an insufficient number of primers in the first range will EPrimer3 return primers in a subsequent range.</text>
</comment>
</parameter>
<parameter>
<name>e_ptmopt</name>
<prompt lang="en">Product optimum tm</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>0.0</value>
</vdef>
<format>
<code proglang="python">("", " -ptmopt=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>29</argpos>
<comment>
<text lang="en">The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature.</text>
</comment>
</parameter>
<parameter>
<name>e_ptmmin</name>
<prompt lang="en">Product minimum tm</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>-1000000.0</value>
</vdef>
<format>
<code proglang="python">("", " -ptmmin=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>30</argpos>
<comment>
<text lang="en">The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details.</text>
</comment>
</parameter>
<parameter>
<name>e_ptmmax</name>
<prompt lang="en">Product maximum tm</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_primer</code>
</precond>
<vdef>
<value>1000000.0</value>
</vdef>
<format>
<code proglang="python">("", " -ptmmax=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>31</argpos>
<comment>
<text lang="en">The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press).
Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length
Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence.
A similar formula is used by the prime primer selection program in GCG, which instead uses 675.0/length in the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to .2 M Na+. EPrimer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions.</text>
</comment>
</parameter>
</parameters>
</paragraph>
<paragraph>
<name>e_oligosinput</name>
<prompt lang="en">Internal oligo input</prompt>
<parameters>
<parameter>
<name>e_oexcludedregion</name>
<prompt lang="en">Internal oligo excluded region</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<format>
<code proglang="python">("", " -oexcludedregion=" + str(value))[value is not None]</code>
</format>
<argpos>32</argpos>
<comment>
<text lang="en">Middle oligos may not overlap any region specified by this tag. The associated value must be a space-separated list of
(start),(end)
pairs, where (start) is the index of the first base of an excluded region, and (end) is the last. Often one would make Target regions excluded regions for internal oligos.</text>
</comment>
</parameter>
<parameter>
<name>e_oligoinput</name>
<prompt lang="en">Internal oligo input sequence (if any)</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<format>
<code proglang="python">("", " -oligoinput=" + str(value))[value is not None]</code>
</format>
<argpos>33</argpos>
<comment>
<text lang="en">The sequence of an internal oligo to check and around which to design forward and reverse primers. Must be a substring of SEQUENCE.</text>
</comment>
</parameter>
</parameters>
</paragraph>
<paragraph>
<name>e_oligosection</name>
<prompt lang="en">Internal oligo options</prompt>
<parameters>
<parameter>
<name>e_osizeopt</name>
<prompt lang="en">Internal oligo optimum size (value greater than or equal to 0)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>20</value>
</vdef>
<format>
<code proglang="python">("", " -osizeopt=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0 is required</text>
</message>
<code proglang="python">value >= 0</code>
</ctrl>
<argpos>34</argpos>
<comment>
<text lang="en">Optimum length (in bases) of an internal oligo. EPrimer3 will attempt to pick primers close to this length.</text>
</comment>
</parameter>
<parameter>
<name>e_ominsize</name>
<prompt lang="en">Internal oligo minimum size (value greater than or equal to 0)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>18</value>
</vdef>
<format>
<code proglang="python">("", " -ominsize=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0 is required</text>
</message>
<code proglang="python">value >= 0</code>
</ctrl>
<argpos>35</argpos>
<comment>
<text lang="en">Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE.</text>
</comment>
</parameter>
<parameter>
<name>e_omaxsize</name>
<prompt lang="en">Internal oligo maximum size (value less than or equal to 35)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>27</value>
</vdef>
<format>
<code proglang="python">("", " -omaxsize=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value less than or equal to 35 is required</text>
</message>
<code proglang="python">value <= 35</code>
</ctrl>
<argpos>36</argpos>
<comment>
<text lang="en">Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which EPrimer3's melting-temperature is valid.</text>
</comment>
</parameter>
<parameter>
<name>e_otmopt</name>
<prompt lang="en">Internal oligo optimum tm</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>60.0</value>
</vdef>
<format>
<code proglang="python">("", " -otmopt=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>37</argpos>
<comment>
<text lang="en">Optimum melting temperature (Celsius) for an internal oligo. EPrimer3 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.</text>
</comment>
</parameter>
<parameter>
<name>e_otmmin</name>
<prompt lang="en">Internal oligo minimum tm</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>57.0</value>
</vdef>
<format>
<code proglang="python">("", " -otmmin=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>38</argpos>
<comment>
<text lang="en">Minimum acceptable melting temperature(Celsius) for an internal oligo.</text>
</comment>
</parameter>
<parameter>
<name>e_otmmax</name>
<prompt lang="en">Internal oligo maximum tm</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>63.0</value>
</vdef>
<format>
<code proglang="python">("", " -otmmax=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>39</argpos>
<comment>
<text lang="en">Maximum acceptable melting temperature (Celsius) for an internal oligo.</text>
</comment>
</parameter>
<parameter>
<name>e_ogcopt</name>
<prompt lang="en">Internal oligo optimum gc percent</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>50.0</value>
</vdef>
<format>
<code proglang="python">("", " -ogcopt=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>40</argpos>
<comment>
<text lang="en">Internal oligo optimum GC percent.</text>
</comment>
</parameter>
<parameter>
<name>e_ogcmin</name>
<prompt lang="en">Internal oligo minimum gc</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>20.0</value>
</vdef>
<format>
<code proglang="python">("", " -ogcmin=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>41</argpos>
<comment>
<text lang="en">Minimum allowable percentage of Gs and Cs in an internal oligo.</text>
</comment>
</parameter>
<parameter>
<name>e_ogcmax</name>
<prompt lang="en">Internal oligo maximum gc</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>80.0</value>
</vdef>
<format>
<code proglang="python">("", " -ogcmax=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>42</argpos>
<comment>
<text lang="en">Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer.</text>
</comment>
</parameter>
<parameter>
<name>e_osaltconc</name>
<prompt lang="en">Internal oligo salt concentration (mm)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>50.0</value>
</vdef>
<format>
<code proglang="python">("", " -osaltconc=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>43</argpos>
<comment>
<text lang="en">The millimolar concentration of salt (usually KCl) in the hybridization. EPrimer3 uses this argument to calculate internal oligo melting temperatures.</text>
</comment>
</parameter>
<parameter>
<name>e_odnaconc</name>
<prompt lang="en">Internal oligo dna concentration (nm)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>50.0</value>
</vdef>
<format>
<code proglang="python">("", " -odnaconc=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>44</argpos>
<comment>
<text lang="en">The nanomolar concentration of annealing internal oligo in the hybridization.</text>
</comment>
</parameter>
<parameter>
<name>e_oanyself</name>
<prompt lang="en">Internal oligo maximum self complementarity (value less than or equal to 9999.99)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>12.00</value>
</vdef>
<format>
<code proglang="python">("", " -oanyself=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value less than or equal to 9999.99 is required</text>
</message>
<code proglang="python">value <= 9999.99</code>
</ctrl>
<argpos>45</argpos>
<comment>
<text lang="en">The maximum allowable local alignment score when testing an internal oligo for (local) self-complementarity. Local self-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment
5' ATCGNA 3'
|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment
5' ATCCGNA 3'
|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.</text>
</comment>
</parameter>
<parameter>
<name>e_oendself</name>
<prompt lang="en">Internal oligo maximum 3' self complementarity (value less than or equal to 9999.99)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>12.00</value>
</vdef>
<format>
<code proglang="python">("", " -oendself=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value less than or equal to 9999.99 is required</text>
</message>
<code proglang="python">value <= 9999.99</code>
</ctrl>
<argpos>46</argpos>
<comment>
<text lang="en">The maximum allowable 3'-anchored global alignment score when testing a single oligo for self-complementarity.
The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5' to 3'.
INTERNAL-OLIGO-SELF-END is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as INTERNAL-OLIGO-SELF-ANY.</text>
</comment>
</parameter>
<parameter>
<name>e_opolyxmax</name>
<prompt lang="en">Internal oligo maximum polynucleotide repeat (value greater than or equal to 0)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>5</value>
</vdef>
<format>
<code proglang="python">("", " -opolyxmax=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0 is required</text>
</message>
<code proglang="python">value >= 0</code>
</ctrl>
<argpos>47</argpos>
<comment>
<text lang="en">The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA.</text>
</comment>
</parameter>
<parameter>
<name>e_omishybmax</name>
<prompt lang="en">Internal oligo maximum mishybridization (value less than or equal to 9999.99)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<precond>
<code proglang="python">e_hybridprobe</code>
</precond>
<vdef>
<value>12.0</value>
</vdef>
<format>
<code proglang="python">("", " -omishybmax=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value less than or equal to 9999.99 is required</text>
</message>
<code proglang="python">value <= 9999.99</code>
</ctrl>
<argpos>48</argpos>
<comment>
<text lang="en">Similar to MAX-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY.</text>
</comment>
</parameter>
</parameters>
</paragraph>
</parameters>
</paragraph>
<paragraph>
<name>e_advanced</name>
<prompt lang="en">Advanced section</prompt>
<parameters>
<parameter>
<name>e_explainflag</name>
<prompt lang="en">Explain flag</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="python">("", " -explainflag")[ bool(value) ]</code>
</format>
<argpos>49</argpos>
<comment>
<text lang="en">If this flag is true, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that EPrimer3 examined, and statistics on the number discarded for various reasons.</text>
</comment>
</parameter>
<parameter>
<name>e_fileflag</name>
<prompt lang="en">Create results files for each sequence</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="python">("", " -fileflag")[ bool(value) ]</code>
</format>
<argpos>50</argpos>
<comment>
<text lang="en">If the associated value is true, then EPrimer3 creates two output files for each input SEQUENCE. File (sequence-id).for lists all acceptable forward primers for (sequence-id), and (sequence-id).rev lists all acceptable reverse primers for (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, EPrimer3 produces a file (sequence-id).int, which lists all acceptable internal oligos.</text>
</comment>
</parameter>
<parameter>
<name>e_firstbaseindex</name>
<prompt lang="en">First base index</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<vdef>
<value>1</value>
</vdef>
<format>
<code proglang="python">("", " -firstbaseindex=" + str(value))[value is not None and value!=vdef]</code>
</format>
<argpos>51</argpos>
<comment>
<text lang="en">This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.)</text>
</comment>
</parameter>
<parameter>
<name>e_pickanyway</name>
<prompt lang="en">Pick anyway</prompt>
<type>
<datatype>
<class>Boolean</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="python">("", " -pickanyway")[ bool(value) ]</code>
</format>
<argpos>52</argpos>
<comment>
<text lang="en">If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints.</text>
</comment>
</parameter>
<parameter>
<name>e_maxmispriming</name>
<prompt lang="en">Primer maximum mispriming (value less than or equal to 9999.99)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<vdef>
<value>12.00</value>
</vdef>
<format>
<code proglang="python">("", " -maxmispriming=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value less than or equal to 9999.99 is required</text>
</message>
<code proglang="python">value <= 9999.99</code>
</ctrl>
<argpos>53</argpos>
<comment>
<text lang="en">The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY.</text>
</comment>
</parameter>
<parameter>
<name>e_pairmaxmispriming</name>
<prompt lang="en">Primer pair maximum mispriming (value less than or equal to 9999.99)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<vdef>
<value>24.00</value>
</vdef>
<format>
<code proglang="python">("", " -pairmaxmispriming=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value less than or equal to 9999.99 is required</text>
</message>
<code proglang="python">value <= 9999.99</code>
</ctrl>
<argpos>54</argpos>
<comment>
<text lang="en">The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY.</text>
</comment>
</parameter>
<parameter>
<name>e_numnsaccepted</name>
<prompt lang="en">Maximum ns accepted in a primer (value greater than or equal to 0)</prompt>
<type>
<datatype>
<class>Integer</class>
</datatype>
</type>
<vdef>
<value>0</value>
</vdef>
<format>
<code proglang="python">("", " -numnsaccepted=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0 is required</text>
</message>
<code proglang="python">value >= 0</code>
</ctrl>
<argpos>55</argpos>
<comment>
<text lang="en">Maximum number of unknown bases (N) allowable in any primer.</text>
</comment>
</parameter>
<parameter>
<name>e_selfany</name>
<prompt lang="en">Maximum self complementarity (value from 0.00 to 9999.99)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<vdef>
<value>8.00</value>
</vdef>
<format>
<code proglang="python">("", " -selfany=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0.00 is required</text>
</message>
<code proglang="python">value >= 0.00</code>
</ctrl>
<ctrl>
<message>
<text lang="en">Value less than or equal to 9999.99 is required</text>
</message>
<code proglang="python">value <= 9999.99</code>
</ctrl>
<argpos>56</argpos>
<comment>
<text lang="en">The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment
5' ATCGNA 3'
...|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment
5' ATCCGNA 3'
...|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.</text>
</comment>
</parameter>
<parameter>
<name>e_selfend</name>
<prompt lang="en">Maximum 3' self complementarity (value greater than or equal to 0.00)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<vdef>
<value>3.00</value>
</vdef>
<format>
<code proglang="python">("", " -selfend=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value greater than or equal to 0.00 is required</text>
</message>
<code proglang="python">value >= 0.00</code>
</ctrl>
<argpos>57</argpos>
<comment>
<text lang="en">The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example
5' ATGCCCTAGCTTCCGGATG 3'
.............||| |||||
..........3' AAGTCCTACATTTAGCCTAGT 5'
or
5' AGGCTATGGGCCTCGCGA 3'
...............||||||
............3' AGCGCTCCGGGTATCGGA 5'
The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment.</text>
</comment>
</parameter>
<paragraph>
<name>e_primerweights</name>
<prompt lang="en">Primer penalty weights</prompt>
<parameters>
<parameter>
<name>e_maxendstability</name>
<prompt lang="en">Maximum 3' end stability (value less than or equal to 999.9999)</prompt>
<type>
<datatype>
<class>Float</class>
</datatype>
</type>
<vdef>
<value>9.0</value>
</vdef>
<format>
<code proglang="python">("", " -maxendstability=" + str(value))[value is not None and value!=vdef]</code>
</format>
<ctrl>
<message>
<text lang="en">Value less than or equal to 999.9999 is required</text>
</message>
<code proglang="python">value <= 999.9999</code>
</ctrl>
<argpos>58</argpos>
<comment>
<text lang="en">The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. EPrimer3 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications', 1993, pp 31-40, Humana Press, Totowa NJ).</text>
</comment>
</parameter>
</parameters>
</paragraph>
</parameters>
</paragraph>
<paragraph>
<name>e_output</name>
<prompt lang="en">Output section</prompt>
<parameters>
<parameter>
<name>e_outfile</name>
<prompt lang="en">Name of the output file (e_outfile)</prompt>
<type>
<datatype>
<class>Filename</class>
</datatype>
</type>
<vdef>
<value>eprimer3.e_outfile</value>
</vdef>
<format>
<code proglang="python">("" , " -outfile=" + str(value))[value is not None]</code>
</format>
<argpos>59</argpos>
</parameter>
<parameter isout="1">
<name>e_outfile_out</name>
<prompt lang="en">outfile_out option</prompt>
<type>
<datatype>
<class>Primer3Report</class>
<superclass>Report</superclass>
</datatype>
</type>
<filenames>
<code proglang="python">e_outfile</code>
</filenames>
</parameter>
</parameters>
</paragraph>
<parameter ishidden="1">
<name>auto</name>
<prompt lang="en">Turn off any prompting</prompt>
<type>
<datatype>
<class>String</class>
</datatype>
</type>
<format>
<code proglang="python">" -auto -stdout"</code>
</format>
<argpos>60</argpos>
</parameter>
</parameters>
</program>
|