/var/lib/mobyle/programs/fastaRename.xml is in mobyle-programs 5.1.2-2.
This file is owned by root:root, with mode 0o644.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 | <?xml version="1.0" encoding="ISO-8859-1"?>
<!-- XML Authors: Herve Menager -->
<!-- 'Biological Software and Databases' Group, Institut Pasteur, Paris. -->
<!-- Distributed under LGPLv2 Licence. Please refer to the COPYING.LIB document. -->
<program>
<head>
<name>fastaRename</name>
<version>1.0</version>
<doc>
<title>fasta header shortener</title>
<description>
<text lang="en">helps out with the 10-character limit of the PHYLIP-PHYML formats</text>
</description>
<authors>Bertrand Néron</authors>
<comment>
<div xmlns="http://www.w3.org/1999/xhtml">
Due to an incompatibility between the PHYLIP format and phyml and morePhyml named rules,
the using of long identifier in phyml or morePhyml failed. We proposed the following workaround:
<ol>
<li>use fastaRename to generate an alignment with short ID and a file of ID mapping</li>
<li>perform your analysis with the alignment with short id</li>
<li>replace the short IDs in your tree (in NEWICK format) with nw_rename and the file of IDs mapping generated at the step 1.</li>
</ol>
</div>
</comment>
</doc>
<category>sequence:formatter</category>
<command>fastaRename</command>
</head>
<parameters>
<parameter ismandatory="1" issimple="1">
<name>input</name>
<prompt lang="en">Input sequence file</prompt>
<example>>VERY_VERY_LONG_ID1
---AAAAGAAAATAGTNNTTCTGGTTGATCCTGCCAGAGGCCATTGCTATCAGGGTNTGACTAAGCCATGCGAGTCGAGAGGTGT-------AAGACCTCGGC
ATACTGCTCAGTAACAC
>>VERY_VERY_LONG_ID2
--------------------------AACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGCGAAAGGGG--GCTTCGGCGGGGGGAGTAGAGTGGC
GCACGGGTGAGTAACGC
>>VERY_VERY_LONG_ID3
TTATGGAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAACGATGAAGCTTTTAGCTTGCTAGAAGTGGATTAGTGGC
GCACGGGTGAGTAATGC
</example>
<type>
<datatype>
<class>Alignment</class>
</datatype>
<dataFormat>FASTA</dataFormat>
</type>
<format>
<code proglang="perl">" $value"</code>
<code proglang="python">" " + str(value)</code>
</format>
<argpos>1</argpos>
</parameter>
<parameter isout="1">
<name>output_fasta</name>
<prompt lang="en">Output file with renamed headers</prompt>
<comment>type any kind of text</comment>
<example>example text</example>
<type>
<datatype>
<class>Alignment</class>
</datatype>
<dataFormat>FASTA</dataFormat>
</type>
<filenames>
<code proglang="perl">"*.rename.fasta"</code>
<code proglang="python">"*.rename.fasta"</code>
</filenames>
</parameter>
<parameter isout="1">
<name>output_map</name>
<prompt lang="en">Output file header map</prompt>
<type>
<datatype>
<class>ID_Mapping</class>
<superclass>AbstractText</superclass>
</datatype>
</type>
<filenames>
<code proglang="perl">"*.map"</code>
<code proglang="python">"*.map"</code>
</filenames>
</parameter>
</parameters>
</program>
|