/usr/include/d/bio/bam/pileup.d is in libbiod-dev 0.1.0-5build1.
This file is owned by root:root, with mode 0o644.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 | /*
This file is part of BioD.
Copyright (C) 2012-2016 Artem Tarasov <lomereiter@gmail.com>
Permission is hereby granted, free of charge, to any person obtaining a
copy of this software and associated documentation files (the "Software"),
to deal in the Software without restriction, including without limitation
the rights to use, copy, modify, merge, publish, distribute, sublicense,
and/or sell copies of the Software, and to permit persons to whom the
Software is furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in
all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
DEALINGS IN THE SOFTWARE.
*/
/// $(P This module is used for iterating over columns of alignment.)
/// $(P The function makePileup is called on
/// a range of coordinate-sorted reads mapped to the same reference.
/// It returns an input range of columns.)
/// $(P This returned range can then be iterated with $(D foreach).
/// First column is located at the same position on the reference,
/// as the first base of the first read.
/// $(BR)
/// Each $(D popFront) operation advances current position on the
/// reference. The default behaviour is to exclude sites with zero coverage
/// from the iteration.)
/// $(P Each column keeps set of reads that overlap corresponding position
/// on the reference.
/// If reads contain MD tags, and makePileup was asked
/// to use them, reference base at the column is also available.)
/// $(BR)
/// Each read preserves all standard read properties
/// but also keeps column-related information, namely
/// <ul>
/// $(LI number of bases consumed from the read sequence so far)
/// $(LI current CIGAR operation and offset in it)
/// $(LI all CIGAR operations before and after current one)</ul>
/// $(BR)
/// It is clear from the above that current CIGAR operation cannot be an insertion.
/// The following are suggested ways to check for them:
/// <ul>
/// $(LI $(D cigar_after.length > 0 &&
/// cigar_operation_offset == cigar_operation.length - 1 &&
/// cigar_after[0].type == 'I'))
/// $(LI $(D cigar_before.length > 0 &&
/// cigar_operation_offset == 0 &&
/// cigar_before[$ - 1].type == 'I'))</ul>
/// $(BR)
/// Example:
/// ---------------------------------------------------------
/// import bio.bam.reader, bio.bam.pileup, std.stdio, std.algorithm : count;
/// void main() {
/// auto bam = new BamReader("file.bam"); // assume single reference and MD tags
/// auto pileup = bam.reads().makePileup(useMD);
/// foreach (column; pileup) {
/// auto matches = column.bases.count(column.reference_base);
/// if (matches < column.coverage * 2 / 3)
/// writeln(column.position); // print positions of possible mismatches
/// }
/// }
/// ---------------------------------------------------------
module bio.bam.pileup;
import bio.bam.read;
import bio.bam.md.reconstruct;
import bio.bam.splitter;
import std.algorithm;
import std.range;
import std.random;
import std.traits;
import std.conv;
import std.array;
import std.exception;
/// Represents a read aligned to a column
struct PileupRead(Read=bio.bam.read.EagerBamRead) {
Read read; ///
alias read this;
private alias read _read;
/// Current CIGAR operation. One of 'M', '=', 'X', 'D', 'N.
/// Use $(D cigar_after)/$(D cigar_before) to determine insertions.
bio.bam.read.CigarOperation cigar_operation() @property const {
return _cur_op;
}
/// Number of bases consumed from the current CIGAR operation.
uint cigar_operation_offset() @property const {
return _cur_op_offset;
}
/// CIGAR operations after the current operation
const(bio.bam.read.CigarOperation)[] cigar_after() @property const {
return _read.cigar[_cur_op_index + 1 .. $];
}
/// CIGAR operations before the current operation
const(bio.bam.read.CigarOperation)[] cigar_before() @property const {
return _read.cigar[0 .. _cur_op_index];
}
/// If current CIGAR operation is one of 'M', '=', or 'X', returns read base
/// at the current column. Otherwise, returns '-'.
char current_base() @property const {
assert(_query_offset <= _read.sequence_length);
if (_cur_op.is_query_consuming && _cur_op.is_reference_consuming) {
return _read.sequence[_query_offset];
} else {
return '-';
}
}
/// If current CIGAR operation is one of 'M', '=', or 'X', returns
/// Phred-scaled read base quality at the current column.
/// Otherwise, returns 255.
ubyte current_base_quality() @property const {
assert(_query_offset <= _read.sequence_length);
if (_cur_op.is_query_consuming && _cur_op.is_reference_consuming) {
return _read.base_qualities[_query_offset];
} else {
return 255;
}
}
/// Returns number of bases consumed from the read sequence.
/// $(BR)
/// More concisely,
/// $(UL
/// $(LI if current CIGAR operation is 'M', '=', or 'X',
/// index of current read base in the read sequence)
/// $(LI if current CIGAR operation is 'D' or 'N',
/// index of read base after the deletion)
/// )
/// (in both cases indices are 0-based)
int query_offset() @property const {
assert(_query_offset <= _read.sequence_length);
return _query_offset;
}
/// Returns duplicate
PileupRead dup() @property {
PileupRead r = void;
r._read = _read; // logically const, thus no .dup here
r._cur_op_index = _cur_op_index;
r._cur_op = _cur_op;
r._cur_op_offset = _cur_op_offset;
r._query_offset = _query_offset;
return r;
}
private {
// index of current CIGAR operation in _read.cigar
uint _cur_op_index;
// current CIGAR operation
CigarOperation _cur_op;
// number of bases consumed from the current CIGAR operation
uint _cur_op_offset;
// number of bases consumed from the read sequence
uint _query_offset;
this(Read read) {
_read = read;
// find first M/=/X/D operation
auto cigar = _read.cigar;
for (_cur_op_index = 0; _cur_op_index < cigar.length; ++_cur_op_index) {
_cur_op = cigar[_cur_op_index];
if (_cur_op.is_reference_consuming) {
if (_cur_op.type != 'N') {
break;
}
} else if (_cur_op.is_query_consuming) {
_query_offset += _cur_op.length; // skip S and I operations
}
}
assertCigarIndexIsValid();
}
// move one base to the right on the reference
void incrementPosition() {
++_cur_op_offset;
// if current CIGAR operation is D or N, query offset is untouched
if (_cur_op.is_query_consuming) {
++_query_offset;
}
if (_cur_op_offset >= _cur_op.length) {
_cur_op_offset = 0; // reset CIGAR operation offset
auto cigar = _read.cigar;
// get next reference-consuming CIGAR operation (M/=/X/D/N)
for (++_cur_op_index; _cur_op_index < cigar.length; ++_cur_op_index) {
_cur_op = cigar[_cur_op_index];
if (_cur_op.is_reference_consuming) {
break;
}
if (_cur_op.is_query_consuming) {
_query_offset += _cur_op.length;
}
}
assertCigarIndexIsValid();
}
}
void assertCigarIndexIsValid() {
assert(_cur_op_index < _read.cigar.length, "Invalid read " ~ _read.name
~ " - CIGAR " ~ _read.cigarString()
~ ", sequence " ~ to!string(_read.sequence));
}
}
}
static assert(isBamRead!(PileupRead!BamRead));
//static assert(isBamRead!(PileupRead!(EagerBamRead!BamRead)));
/// Represents a single pileup column
struct PileupColumn(R) {
private {
ulong _position;
int _ref_id = -1;
R _reads;
size_t _n_starting_here;
}
/// Reference base. 'N' if not available.
char reference_base() @property const {
return _reference_base;
}
private char _reference_base = 'N';
/// Coverage at this position (equals to number of reads)
size_t coverage() const @property {
return _reads.length;
}
/// Returns reference ID (-1 if unmapped)
int ref_id() const @property {
return _ref_id;
}
/// Position on the reference
ulong position() const @property {
return _position;
}
/// Reads overlapping the position, sorted by coordinate
auto reads() @property {
return assumeSorted!compareCoordinates(_reads[]);
}
/// Reads that have leftmost mapped position at this column
auto reads_starting_here() @property {
return _reads[$ - _n_starting_here .. $];
}
/// Shortcut for map!(read => read.current_base)(reads)
auto bases() @property {
return map!"a.current_base"(reads);
}
/// Shortcut for map!(read => read.current_base_quality)(reads)
auto base_qualities() @property {
return map!"a.current_base_quality"(reads);
}
/// Shortcut for map!(read => read.mapping_quality)(reads)
auto read_qualities() @property {
return map!"a.mapping_quality"(reads);
}
}
/**
* The class for iterating reference bases together with reads overlapping them.
*/
class PileupRange(R, alias TColumn=PileupColumn) {
alias Unqual!(ElementType!R) Raw;
alias EagerBamRead!Raw Eager;
alias PileupRead!Eager Read;
alias Read[] ReadArray;
alias TColumn!ReadArray Column;
private {
R _reads;
Column _column;
Appender!ReadArray _read_buf;
bool _skip_zero_coverage;
}
protected {
// This is extracted into a method not only to reduce duplication
// (not so much of it), but to allow to override it!
// For that reason it is not marked as final. Overhead of virtual
// function is negligible compared to computations in EagerBamRead
// constructor together with inserting new element into appender.
void add(ref Raw read) {
_read_buf.put(PileupRead!Eager(Eager(read)));
}
}
/**
* Create new pileup iterator from a range of reads.
*/
this(R reads, bool skip_zero_coverage) {
_reads = reads;
_read_buf = appender!ReadArray();
_skip_zero_coverage = skip_zero_coverage;
if (!_reads.empty) {
initNewReference(); // C++ programmers, don't worry! Virtual tables in D
// are populated before constructor body is executed.
}
}
/// Returns PileupColumn struct corresponding to the current position.
ref Column front() @property {
return _column;
}
/// Whether all reads have been processed.
bool empty() @property {
return _reads.empty && _read_buf.data.empty;
}
/// Move to next position on the reference.
void popFront() {
auto pos = ++_column._position;
size_t survived = 0;
auto data = _read_buf.data;
for (size_t i = 0; i < data.length; ++i) {
if (data[i].end_position > pos) {
if (survived < i)
{
data[survived] = data[i];
}
++survived;
}
}
for (size_t i = 0; i < survived; ++i) {
data[i].incrementPosition();
}
// unless range is empty, this value is
_read_buf.shrinkTo(survived);
_column._n_starting_here = 0; // updated either in initNewReference()
// or in the loop below
if (!_reads.empty) {
if (_reads.front.ref_id != _column._ref_id &&
survived == 0) // processed all reads aligned to the previous reference
{
initNewReference();
} else {
size_t n = 0;
while (!_reads.empty &&
_reads.front.position == pos &&
_reads.front.ref_id == _column._ref_id)
{
auto read = _reads.front;
add(read);
_reads.popFront();
++n;
}
_column._n_starting_here = n;
// handle option of skipping sites with zero coverage
if (survived == 0 && n == 0 && _skip_zero_coverage) {
// the name might be misleading but it does the trick
initNewReference();
}
}
}
_column._reads = _read_buf.data;
}
protected void initNewReference() {
auto read = _reads.front;
_column._position = read.position;
_column._ref_id = read.ref_id;
uint n = 1;
add(read);
_reads.popFront();
while (!_reads.empty) {
read = _reads.front;
if (read.ref_id == _column.ref_id &&
read.position == _column._position)
{
add(read);
++n;
_reads.popFront();
} else {
break;
}
}
_column._n_starting_here = n;
_column._reads = _read_buf.data;
}
}
/// Abstract pileup structure. S is type of column range.
struct AbstractPileup(R, S) {
private R reads_;
R reads() @property {
return reads_;
}
S columns;
/// Pileup columns
alias columns this;
private {
ulong _start_position;
ulong _end_position;
int _ref_id;
}
/// $(D start_from) parameter provided to a pileup function
ulong start_position() @property const {
return _start_position;
}
/// $(D end_at) parameter provided to a pileup function
ulong end_position() @property const {
return _end_position;
}
/// Reference ID of all reads in this pileup.
int ref_id() @property const {
return _ref_id;
}
}
struct TakeUntil(alias pred, Range, Sentinel) if (isInputRange!Range)
{
private Range _input;
private Sentinel _sentinel;
bool _done;
this(Range input, Sentinel sentinel) {
_input = input; _sentinel = sentinel; _done = _input.empty || predSatisfied();
}
@property bool empty() { return _done; }
@property auto ref front() { return _input.front; }
private bool predSatisfied() { return startsWith!pred(_input, _sentinel); }
void popFront() { _input.popFront(); _done = _input.empty || predSatisfied(); }
}
auto takeUntil(alias pred, Range, Sentinel)(Range range, Sentinel sentinel) {
return TakeUntil!(pred, Range, Sentinel)(range, sentinel);
}
auto pileupInstance(alias P, R)(R reads, ulong start_from, ulong end_at, bool skip_zero_coverage) {
auto rs = filter!"a.basesCovered() > 0"(reads);
while (!rs.empty) {
auto r = rs.front;
if (r.position + r.basesCovered() < start_from) {
rs.popFront();
} else {
break;
}
}
int ref_id = -1;
if (!rs.empty) {
ref_id = rs.front.ref_id;
}
auto sameref_rs = takeUntil!"a.ref_id != b"(rs, ref_id);
alias typeof(sameref_rs) ReadRange;
PileupRange!ReadRange columns = new P!ReadRange(sameref_rs, skip_zero_coverage);
while (!columns.empty) {
auto c = columns.front;
if (c.position < start_from) {
columns.popFront();
} else {
break;
}
}
auto chopped = takeUntil!"a.position >= b"(columns, end_at);
return AbstractPileup!(R, typeof(chopped))(reads, chopped, start_from, end_at, ref_id);
}
auto pileupColumns(R)(R reads, bool use_md_tag=false, bool skip_zero_coverage=true) {
auto rs = filter!"a.basesCovered() > 0"(reads);
alias typeof(rs) ReadRange;
PileupRange!ReadRange columns;
if (use_md_tag) {
columns = new PileupRangeUsingMdTag!ReadRange(rs, skip_zero_coverage);
} else {
columns = new PileupRange!ReadRange(rs, skip_zero_coverage);
}
return columns;
}
/// Tracks current reference base
final static class PileupRangeUsingMdTag(R) :
PileupRange!(R, PileupColumn)
{
// The code is similar to that in reconstruct.d but here we can't make
// an assumption about any particular read having non-zero length on reference.
// current chunk of reference
private alias typeof(_column._reads[].front) Read;
private ReturnType!(dna!Read) _chunk;
// end position of the current chunk on reference (assuming half-open interval)
private uint _chunk_end_position;
// next read from which we will extract reference chunk
//
// More precisely,
// _next_chunk_provider = argmax (read => read.end_position)
// {reads overlapping current column}
private Read _next_chunk_provider;
private bool _has_next_chunk_provider = false;
// coverage at the previous location
private ulong _prev_coverage;
// we also track current reference ID
private int _curr_ref_id = -1;
///
this(R reads, bool skip_zero_coverage) {
super(reads, skip_zero_coverage);
}
alias Unqual!(ElementType!R) Raw;
// Checks length of the newly added read and tracks the read which
// end position on the reference is the largest.
//
// When reconstructed reference chunk will become empty, next one will be
// constructed from that read. This algorithm allows to minimize the number
// of reads for which MD tag will be decoded.
protected override void add(ref Raw read) {
// the behaviour depends on whether a new contig starts here or not
bool had_zero_coverage = _prev_coverage == 0;
super.add(read);
// get wrapped read
auto _read = _read_buf.data.back;
// if we've just moved to another reference sequence, do the setup
if (_read.ref_id != _curr_ref_id) {
_curr_ref_id = _read.ref_id;
_has_next_chunk_provider = true;
_next_chunk_provider = _read;
return;
}
// two subsequent next_chunk_providers must overlap
// unless (!) there was a region with zero coverage in-between
if (_read.position > _chunk_end_position && !had_zero_coverage) {
return;
}
// compare with previous candidate and replace if this one is better
if (_read.end_position > _chunk_end_position) {
if (!_has_next_chunk_provider) {
_has_next_chunk_provider = true;
_next_chunk_provider = _read;
} else if (_read.end_position > _next_chunk_provider.end_position) {
_next_chunk_provider = _read;
}
}
}
protected override void initNewReference() {
_prev_coverage = 0;
super.initNewReference();
if (_has_next_chunk_provider) {
// prepare first chunk
_chunk = dna(_next_chunk_provider);
_chunk_end_position = _next_chunk_provider.end_position;
_has_next_chunk_provider = false;
_column._reference_base = _chunk.front;
_chunk.popFront();
} else {
_column._reference_base = 'N';
}
}
///
override void popFront() {
if (!_chunk.empty) {
// update current reference base
_column._reference_base = _chunk.front;
_chunk.popFront();
} else {
_column._reference_base = 'N';
}
// update _prev_coverage
_prev_coverage = _column.coverage;
// the order is important - maybe we will obtain new next_chunk_provider
// during this call to popFront()
super.popFront();
// If we have consumed the whole current chunk,
// we need to obtain the next one if it's possible.
if (_chunk.empty && _has_next_chunk_provider) {
_chunk = dna(_next_chunk_provider);
debug {
/* import std.stdio;
writeln();
writeln("position: ", _next_chunk_provider.position);
writeln("next chunk: ", to!string(_chunk));
*/
}
_chunk_end_position = _next_chunk_provider.end_position;
_has_next_chunk_provider = false;
_chunk.popFrontN(cast(size_t)(_column.position - _next_chunk_provider.position));
_column._reference_base = _chunk.front;
_chunk.popFront();
}
}
}
/// Creates a pileup range from a range of reads.
/// Note that all reads must be aligned to the same reference.
///
/// See $(D PileupColumn) documentation for description of range elements.
/// Note also that you can't use $(D std.array.array()) function on pileup
/// because it won't make deep copies of underlying data structure.
/// (One might argue that in this case it would be better to use opApply,
/// but typically one would use $(D std.algorithm.map) on pileup columns
/// to obtain some numeric characteristics.)
///
/// Params:
/// use_md_tag = if true, use MD tag together with CIGAR
/// to recover reference bases
///
/// start_from = position from which to start
///
/// end_at = position before which to stop
///
/// $(BR)
/// That is, the range of positions is half-open interval
/// $(BR)
/// [max(start_from, first mapped read start position),
/// $(BR)
/// min(end_at, last mapped end position among all reads))
///
/// skip_zero_coverage = if true, skip sites with zero coverage
///
auto makePileup(R)(R reads,
bool use_md_tag=false,
ulong start_from=0,
ulong end_at=ulong.max,
bool skip_zero_coverage=true)
{
if (use_md_tag) {
return pileupInstance!PileupRangeUsingMdTag(reads, start_from, end_at, skip_zero_coverage);
} else {
return pileupInstance!PileupRange(reads, start_from, end_at, skip_zero_coverage);
}
}
/// Allows to express the intention clearer.
enum useMD = true;
unittest {
import std.algorithm;
import std.range;
import std.array;
// the set of reads below was taken from 1000 Genomes BAM file
// NA20828.mapped.ILLUMINA.bwa.TSI.low_coverage.20101123.bam
// (region 20:1127810-1127819)
auto readnames = array(iota(10).map!(i => "r" ~ to!string(i))());
auto sequences = ["ATTATGGACATTGTTTCCGTTATCATCATCATCATCATCATCATCATTATCATC",
"GACATTGTTTCCGTTATCATCATCATCATCATCATCATCATCATCATCATCATC",
"ATTGTTTCCGTTATCATCATCATCATCATCATCATCATCATCATCATCATCACC",
"TGTTTCCGTTATCATCATCATCATCATCATCATCATCATCATCATCATCACCAC",
"TCCGTTATCATCATCATCATCATCATCATCATCATCATCATCATCACCACCACC",
"GTTATCATCATCATCATCATCATCATCATCATCATCATCATCATCGTCACCCTG",
"TCATCATCATCATAATCATCATCATCATCATCATCATCGTCACCCTGTGTTGAG",
"TCATCATCATCGTCACCCTGTGTTGAGGACAGAAGTAATTTCCCTTTCTTGGCT",
"TCATCATCATCATCACCACCACCACCCTGTGTTGAGGACAGAAGTAATATCCCT",
"CACCACCACCCTGTGTTGAGGACAGAAGTAATTTCCCTTTCTTGGCTGGTCACC"];
// multiple sequence alignment:
// ***
// ATTATGGACATTGTTTCCGTTATCATCATCATCATCATCATCATCATTATCATC
// GACATTGTTTCCGTTATCATCATCATCATCATCATCATCATCATCATCATCAT---C
// ATTGTTTCCGTTATCATCATCATCATCATCATCATCATCATCATCATCATCACC
// TGTTTCCGTTATCATCATCATCATCATCATCATCATCATCATCATCAT---CACCAC
// TCCGTTATCATCATCATCATCATCATCATCATCATCATCATCAT---CACCACCACC
// GTTATCATCATCATCATCATCATCATCATCATCATCATCAT---CATCGTCACCCTG
// ATCATCATCATAATCATCATCATCATCATCAT---CATCGTCACCCTGTGTTGAG
// TCATCATCATCGTCAC------------------CCTGTGTTGAGGACAGAAGTAATTTCCCTTTCTTGGCT
// TCATCATCATCATCACCACCACCACCCTGTGTTGAGGACAGAAGTAATATCCCT
// ---CACCACCACCCTGTGTTGAGGACAGAAGTAATTTCCCTTTCTTGGCTGGTCACC
// * * * * * * * * * *
// 760 770 780 790 800 810 820 830 840 850
auto cigars = [[CigarOperation(54, 'M')],
[CigarOperation(54, 'M')],
[CigarOperation(50, 'M'), CigarOperation(3, 'I'), CigarOperation(1, 'M')],
[CigarOperation(54, 'M')],
[CigarOperation(54, 'M')],
[CigarOperation(54, 'M')],
[CigarOperation(2, 'S'), CigarOperation(52, 'M')],
[CigarOperation(16, 'M'), CigarOperation(15, 'D'), CigarOperation(38, 'M')],
[CigarOperation(13, 'M'), CigarOperation(3, 'I'), CigarOperation(38, 'M')],
[CigarOperation(54, 'M')]];
auto positions = [758, 764, 767, 769, 773, 776, 785, 795, 804, 817];
auto md_tags = ["47C6", "54", "51", "50T3", "46T7", "45A0C7", "11C24A0C14",
"11A3T0^CATCATCATCACCAC38", "15T29T5", "2T45T5"];
BamRead[] reads = new BamRead[10];
foreach (i; iota(10)) {
reads[i] = BamRead(readnames[i], sequences[i], cigars[i]);
reads[i].position = positions[i];
reads[i].ref_id = 0;
reads[i]["MD"] = md_tags[i];
}
auto first_read_position = reads.front.position;
auto reference = to!string(dna(reads));
import std.stdio;
writeln("Testing pileup (low-level aspects)...");
auto pileup = makePileup(reads, true, 796, 849, false);
auto pileup2 = makePileup(reads, true, 0, ulong.max, false);
assert(pileup.front.position == 796);
assert(pileup.start_position == 796);
assert(pileup.end_position == 849);
while (pileup2.front.position != 796) {
pileup2.popFront();
}
while (!pileup.empty) {
auto column = pileup.front;
auto column2 = pileup2.front;
assert(column.coverage == column2.coverage);
pileup2.popFront();
// check that DNA is built correctly from MD tags and CIGAR
assert(column.reference_base == reference[cast(size_t)(column.position - first_read_position)]);
switch (column.position) {
case 796:
assert(equal(column.bases, "CCCCCCAC"));
pileup.popFront();
break;
case 805:
assert(equal(column.bases, "TCCCCCCCC"));
pileup.popFront();
break;
case 806:
assert(equal(column.bases, "AAAAAAAGA"));
pileup.popFront();
break;
case 810:
// last read is not yet fetched by pileup engine
assert(column.reads[column.coverage - 2].cigar_after.front.type == 'D');
pileup.popFront();
break;
case 817:
assert(column.reads[column.coverage - 2].cigar_before.back.type == 'I');
pileup.popFront();
break;
case 821:
assert(column.reads[column.coverage - 3].cigar_operation.type == 'D');
assert(equal(column.bases, "AAGG-AA"));
pileup.popFront();
break;
case 826:
assert(equal(column.bases, "CCCCCC"));
pileup.popFront();
break;
case 849:
assert(equal(column.bases, "TAT"));
pileup.popFront();
assert(pileup.empty);
break;
default:
pileup.popFront();
break;
}
}
// another set of reads, the same file, region 20:12360032-12360050
// test the case when reference has some places with zero coverage
reads = [BamRead("r1", "CCCACATAGAAAGCTTGCTGTTTCTCTGTGGGAAGTTTTAACTTAGGTCAGCTT",
[CigarOperation(54, 'M')]),
BamRead("r2", "TAGAAAGCTTGCTGTTTCTCTGTGGGAAGTTTTAACTTAGGTTAGCTTCATCTA",
[CigarOperation(54, 'M')]),
BamRead("r3", "TTTTTCTTTCTTTCTTTGAAGAAGGCAGATTCCTGGTCCTGCCACTCAAATTTT",
[CigarOperation(54, 'M')]),
BamRead("r4", "TTTCTTTCTTTCTTTGAAGAAGGCAGATTCCTGGTCCTGCCACTCAAATTTTCA",
[CigarOperation(54, 'M')])];
reads[0].position = 979;
reads[0]["MD"] = "54";
reads[0].ref_id = 0;
reads[1].position = 985;
reads[1]["MD"] = "42C7C3";
reads[1].ref_id = 0;
reads[2].position = 1046;
reads[2]["MD"] = "54";
reads[2].ref_id = 0;
reads[3].position = 1048;
reads[3]["MD"] = "54";
reads[3].ref_id = 0;
assert(equal(dna(reads),
map!(c => c.reference_base)(makePileup(reads, true, 0, ulong.max, false))));
}
struct PileupChunkRange(C) {
private C _chunks;
private ElementType!C _prev_chunk;
private ElementType!C _current_chunk;
private bool _empty;
private ulong _beg = 0;
private bool _use_md_tag;
private ulong _start_from;
private ulong _end_at;
private int _chunk_right_end;
private int computeRightEnd(ref ElementType!C chunk) {
return chunk.map!(r => r.position + r.basesCovered()).reduce!max;
}
this(C chunks, bool use_md_tag, ulong start_from, ulong end_at) {
_chunks = chunks;
_use_md_tag = use_md_tag;
_start_from = start_from;
_end_at = end_at;
while (true) {
if (_chunks.empty) {
_empty = true;
} else {
_current_chunk = _chunks.front;
_chunks.popFront();
if (_current_chunk[0].ref_id < 0) continue;
_beg = _current_chunk[0].position;
if (_beg >= end_at) {
_empty = true;
break;
}
_chunk_right_end = computeRightEnd(_current_chunk);
if (_chunk_right_end > start_from)
break;
}
}
}
bool empty() @property {
return _empty;
}
auto front() @property {
auto end_pos = _current_chunk[$-1].position;
if (_chunks.empty || _chunks.front[0].ref_id != _current_chunk[$-1].ref_id)
end_pos = _chunk_right_end;
return makePileup(chain(_prev_chunk, _current_chunk),
_use_md_tag,
max(_beg, _start_from), min(end_pos, _end_at));
}
void popFront() {
_prev_chunk = _current_chunk;
while (true) {
if (_chunks.empty) {
_empty = true;
return;
}
_current_chunk = _chunks.front;
_chunks.popFront();
if (_current_chunk[0].ref_id >= 0) break;
}
_chunk_right_end = computeRightEnd(_current_chunk);
// if we changed reference, nullify prev_chunk
if (_prev_chunk.length > 0 &&
_prev_chunk[$ - 1].ref_id == _current_chunk[0].ref_id)
{
_beg = _prev_chunk[$-1].position;
} else {
_beg = _current_chunk[0].position;
_prev_chunk.length = 0;
}
// keep only those reads in _prev_chunk that have overlap with the last one
// 1) estimate read length
enum sampleSize = 15;
int[sampleSize] buf = void;
int read_length = void;
if (_prev_chunk.length <= sampleSize) {
for (size_t k = 0; k < _prev_chunk.length; ++k) {
buf[k] = _prev_chunk[k].sequence_length;
}
topN(buf[0.._prev_chunk.length], _prev_chunk.length / 2);
read_length = buf[_prev_chunk.length / 2];
} else {
size_t i = 0;
foreach (read; randomSample(_prev_chunk, sampleSize))
buf[i++] = read.sequence_length;
topN(buf[], sampleSize / 2);
read_length = buf[sampleSize / 2];
debug {
import std.stdio;
stderr.writeln("[pileupChunks] read_length=", read_length);
}
}
// 2) do binary search for those reads that start from (_beg - 2 * read_length)
// (it's an experimental fact that almost none of reads consumes that much
// on a reference sequence)
auto pos = _beg - 2 * read_length;
long i = 0;
long j = _prev_chunk.length - 1;
// positions of _prev_chunk[0 .. i] are less than pos,
// positions of _prev_chunk[j + 1 .. $] are more or equal to pos.
while (i <= j) {
auto m = cast(size_t)(i + j) / 2;
assert(m < _prev_chunk.length);
auto p = _prev_chunk[m].position;
if (p >= pos) {
j = m - 1;
} else {
i = m + 1;
}
}
_prev_chunk = _prev_chunk[cast(size_t)i .. $];
}
}
/// This function constructs range of non-overlapping consecutive pileups from a range of reads
/// so that these pileups can be processed in parallel.
///
/// It's allowed to pass ranges of sorted reads with different ref. IDs,
/// they won't get mixed in any chunk.
///
/// Params:
/// use_md_tag = recover reference bases from MD tag and CIGAR
///
/// block_size = approximate amount of memory that each pileup will consume,
/// given in bytes. (Usually consumption will be a bit higher.)
///
/// start_from = position of the first column of the first chunk
///
/// end_at = position after the last column of the last chunk
///
/// $(BR)
/// WARNING: block size should be big enough so that every block will share
/// some reads only with adjacent blocks.
/// $(BR)
/// As such, it is not recommended to reduce the $(I block_size).
/// But there might be a need to increase it in case of very high coverage.
auto pileupChunks(R)(R reads, bool use_md_tag=false, size_t block_size=16_384_000,
ulong start_from=0, ulong end_at=ulong.max) {
auto chunks = chunksConsumingLessThan(reads, block_size);
return PileupChunkRange!(typeof(chunks))(chunks, use_md_tag, start_from, end_at);
}
|