/usr/share/bedtools/test/intersect/test-intersect.sh is in bedtools-test 2.25.0-1.
This file is owned by root:root, with mode 0o755.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 | #!/bin/bash
BT=${BT-../../bin/bedtools}
check()
{
if diff $1 $2; then
echo ok
else
echo fail
fi
}
###########################################################
# Test a basic self intersection
############################################################
echo " intersect.t01...\c"
echo \
"chr1 10 20 a1 1 +
chr1 100 200 a2 2 -" > exp
$BT intersect -a a.bed -b a.bed > obs
check obs exp
rm obs exp
###########################################################
# Test a basic self intersection with -v
############################################################
echo " intersect.t02...\c"
# expectation is empty set
touch exp
$BT intersect -a a.bed -b a.bed -v > obs
check obs exp
rm obs exp
###########################################################
# Test -c
############################################################
echo " intersect.t03...\c"
echo \
"chr1 10 20 a1 1 + 0
chr1 100 200 a2 2 - 2" > exp
$BT intersect -a a.bed -b b.bed -c > obs
check obs exp
rm obs exp
###########################################################
# Test -c with -s
############################################################
echo " intersect.t04...\c"
echo \
"chr1 10 20 a1 1 + 0
chr1 100 200 a2 2 - 1" > exp
$BT intersect -a a.bed -b b.bed -c -s > obs
check obs exp
rm obs exp
###########################################################
# Test -c with -s and -f
############################################################
echo " intersect.t05...\c"
echo \
"chr1 10 20 a1 1 + 0
chr1 100 200 a2 2 - 0" > exp
$BT intersect -a a.bed -b b.bed -c -s -f 0.1 > obs
check obs exp
rm obs exp
###########################################################
# Test plain a and b intersect
############################################################
echo " intersect.t06...\c"
echo \
"chr1 100 101 a2 2 -
chr1 100 110 a2 2 -" > exp
$BT intersect -a a.bed -b b.bed > obs
check obs exp
rm obs exp
###########################################################
# Test with -wa
############################################################
echo " intersect.t07...\c"
echo \
"chr1 100 200 a2 2 -
chr1 100 200 a2 2 -" > exp
$BT intersect -a a.bed -b b.bed -wa > obs
check obs exp
rm obs exp
###########################################################
# Test with -wa and -wb
############################################################
echo " intersect.t08...\c"
echo \
"chr1 100 200 a2 2 - chr1 90 101 b2 2 -
chr1 100 200 a2 2 - chr1 100 110 b3 3 +" > exp
$BT intersect -a a.bed -b b.bed -wa -wb > obs
check obs exp
rm obs exp
###########################################################
# Test with -wo (write overlap)
############################################################
echo " intersect.t09...\c"
echo \
"chr1 100 200 a2 2 - chr1 90 101 b2 2 - 1
chr1 100 200 a2 2 - chr1 100 110 b3 3 + 10" > exp
$BT intersect -a a.bed -b b.bed -wo > obs
check obs exp
rm obs exp
###########################################################
# Test with -wao (write all overlap)
############################################################
echo " intersect.t10...\c"
echo \
"chr1 10 20 a1 1 + . -1 -1 . -1 . 0
chr1 100 200 a2 2 - chr1 90 101 b2 2 - 1
chr1 100 200 a2 2 - chr1 100 110 b3 3 + 10" > exp
$BT intersect -a a.bed -b b.bed -wao > obs
check obs exp
rm obs exp
###########################################################
# Test with -wo (write overlap) with -s
############################################################
echo " intersect.t11...\c"
echo \
"chr1 100 200 a2 2 - chr1 90 101 b2 2 - 1" > exp
$BT intersect -a a.bed -b b.bed -wo -s > obs
check obs exp
rm obs exp
###########################################################
# Test with -wao (write all overlap) with -s
############################################################
echo " intersect.t12...\c"
echo \
"chr1 10 20 a1 1 + . -1 -1 . -1 . 0
chr1 100 200 a2 2 - chr1 90 101 b2 2 - 1" > exp
$BT intersect -a a.bed -b b.bed -wao -s > obs
check obs exp
rm obs exp
###########################################################
# Test A as -
############################################################
echo " intersect.t13...\c"
echo \
"chr1 100 101 a2 2 -
chr1 100 110 a2 2 -" > exp
cat a.bed | $BT intersect -a - -b b.bed > obs
check obs exp
rm obs exp
###########################################################
# Test A as stdin
############################################################
echo " intersect.t14...\c"
echo \
"chr1 100 101 a2 2 -
chr1 100 110 a2 2 -" > exp
cat a.bed | $BT intersect -a stdin -b b.bed > obs
check obs exp
rm obs exp
###########################################################
# Test B as -
############################################################
echo " intersect.t15...\c"
echo \
"chr1 100 101 a2 2 -
chr1 100 110 a2 2 -" > exp
cat b.bed | $BT intersect -a a.bed -b - > obs
check obs exp
rm obs exp
###########################################################
# Test A as stdin
############################################################
echo " intersect.t16...\c"
echo \
"chr1 100 101 a2 2 -
chr1 100 110 a2 2 -" > exp
cat b.bed | $BT intersect -a a.bed -b stdin > obs
check obs exp
rm obs exp
###########################################################
###########################################################
# -split #
###########################################################
###########################################################
samtools view -Sb one_block.sam > one_block.bam 2>/dev/null
samtools view -Sb two_blocks.sam > two_blocks.bam 2>/dev/null
samtools view -Sb three_blocks.sam > three_blocks.bam 2>/dev/null
##################################################################
# Test three blocks matches BED without -split
##################################################################
echo " intersect.t17...\c"
echo \
"three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp
$BT intersect -abam three_blocks.bam -b three_blocks_nomatch.bed | samtools view - > obs
check obs exp
rm obs exp
##################################################################
# Test three blocks does not match BED with -split
##################################################################
echo " intersect.t18...\c"
touch exp
$BT intersect -abam three_blocks.bam -b three_blocks_nomatch.bed -split | samtools view - > obs
check obs exp
rm obs exp
##################################################################
# Test three blocks matches BED with -split
##################################################################
echo " intersect.t19...\c"
echo \
"three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp
$BT intersect -abam three_blocks.bam -b three_blocks_match.bed -split | samtools view - > obs
check obs exp
rm obs exp
##################################################################
# Test three blocks does not match BED with -split and -s
# BAM os -, BED is +
##################################################################
echo " intersect.t20...\c"
touch exp
$BT intersect -abam three_blocks.bam -b three_blocks_match.bed -split -s | samtools view - > obs
check obs exp
rm obs exp
##################################################################
# Test three blocks match BED that overlap 1bp with -split
##################################################################
echo " intersect.t21...\c"
echo \
"three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp
$BT intersect -abam three_blocks.bam -b three_blocks_match_1bp.bed -split | samtools view - > obs
check obs exp
rm obs exp
################################################################################
# Test three blocks does not match BED that overlap 1bp with -split and -f 0.1
################################################################################
echo " intersect.t22...\c"
touch exp
$BT intersect -abam three_blocks.bam -b three_blocks_match_1bp.bed -split -f 0.1 | samtools view - > obs
check obs exp
rm obs exp
###########################################################
# Test three blocks with -split -wo only shows 5 overlap
# bases, not ten.
############################################################
echo " intersect.t22.a...\c"
echo "chr1 0 50 three_blocks_match 0 + 0 0 0 3 10,10,10, 0,20,40, chr1 5 15 5" > exp
$BT intersect -a three_blocks_match.bed -b d.bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Same test but for BAM file
############################################################
echo " intersect.t22.b...\c"
echo "chr1 0 50 three_blocks_match 255 + 0 50 0,0,0 3 10,10,10, 0,20,40, chr1 5 15 5" > exp
$BT intersect -a three_blocks_match.bam -b d.bed -split -wo -bed > obs
check obs exp
rm obs exp
###########################################################
# Test three blocks with -split -wo, and DB record also has
# blocks that somewhat intersect
############################################################
echo " intersect.t22.c...\c"
echo "chr1 0 50 three_blocks_match 0 + 0 0 0 3 10,10,10, 0,20,40, chr1 0 45 three_blocks_match 0 + 0 0 0 2 5,10, 25,35, 10" > exp
$BT intersect -a three_blocks_match.bed -b two_blocks_partial.bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Same test but for BAM file
############################################################
echo " intersect.t22.d...\c"
echo "chr1 0 50 three_blocks_match 255 + 0 50 0,0,0 3 10,10,10, 0,20,40, chr1 0 45 three_blocks_match 0 + 0 0 0 2 5,10, 25,35, 10" > exp
$BT intersect -a three_blocks_match.bam -b two_blocks_partial.bed -split -wo -bed > obs
check obs exp
rm obs exp
###########################################################
# Test three blocks with -split -wo, and DB record also has
# blocks that do not intersect
############################################################
echo " intersect.t22.e...\c"
touch exp
$BT intersect -a three_blocks_match.bed -b three_blocks_nomatch.bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Same test but for BAM file
############################################################
echo " intersect.t22.f...\c"
touch exp
$BT intersect -a three_blocks_match.bam -b three_blocks_nomatch.bed -split -wo -bed > obs
check obs exp
rm obs exp
###########################################################
# Added split test from bug150. See that overlap bases
# with -split are correctly affected by overlap fraction
############################################################
echo " intersect.t22.g...\c"
echo \
"chr2 1000 16385 A 0 - 0 0 0 2 1,1, 0,15384, chr2 1000 16385 A 0 - 0 0 0 2 1,1, 0,15384, 2" > exp
$BT intersect -a bug150_a.bed -b bug150_b.bed -s -split -wo > obs
check exp obs
rm exp obs
##################################################################
# Test that only the mapped read is is found as an intersection
##################################################################
echo " intersect.t23...\c"
echo \
"mapped 16 chr1 1 40 30M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp
samtools view -Sb mapped_and_unmapped.sam 2>/dev/null | $BT intersect -abam - -b a.bed | samtools view - > obs
check obs exp
rm obs exp
##################################################################
# Test that an unmapped read is handled properly with -v
##################################################################
echo " intersect.t24...\c"
echo \
"umapped 4 * 1 40 30M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp
samtools view -Sb mapped_and_unmapped.sam 2>/dev/null | $BT intersect -abam - -b a.bed -v | samtools view - > obs
check obs exp
rm obs exp
##################################################################
# Test -c with BAM input
##################################################################
echo " intersect.t25...\c"
echo \
"chr1 0 30 one_blocks 40 - 0 30 0,0,0 1 30, 0, 1" > exp
$BT intersect -abam one_block.bam -b c.bed -c -bed > obs
check obs exp
rm obs exp
##################################################################
# Test -wo with BAM input
##################################################################
echo " intersect.t26...\c"
echo \
"chr1 0 30 one_blocks 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 c1 1 + 30" > exp
$BT intersect -abam one_block.bam -b c.bed -wo -bed > obs
check obs exp
rm obs exp
##################################################################
# Test -wao with BAM input
##################################################################
echo " intersect.t27...\c"
echo \
"chr1 0 30 one_blocks 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 c1 1 + 30" > exp
$BT intersect -abam one_block.bam -b c.bed -wo -bed > obs
check obs exp
##################################################################
# Test BED3 with BED3
##################################################################
echo " intersect.t28...\c"
echo \
"chr1^I10^I20^Ichr1^I10^I20" > exp
$BT intersect -a bed3.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test BED4 with BED3
##################################################################
echo " intersect.t29...\c"
echo \
"chr1^I10^I20^I345.7^Ichr1^I10^I20" > exp
$BT intersect -a bed4.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test BED5 with BED3
##################################################################
echo " intersect.t30...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^Ichr1^I10^I20" > exp
$BT intersect -a bed5.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test BED6 (without a proper strand) with BED3
##################################################################
echo " intersect.t31...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I11^Ichr1^I10^I20" > exp
$BT intersect -a bed6.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test BED6 (with a strand) with BED3
##################################################################
echo " intersect.t32...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I-^Ichr1^I10^I20" > exp
$BT intersect -a bed6.strand.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test BED PLUS with BED3
##################################################################
echo " intersect.t33...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I11^Ifoo^Ibar^Ibiz^I11^Ibang^Ibop^I99^Ichr1^I10^I20" > exp
$BT intersect -a bedplus.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test for strand matches with BED3
##################################################################
echo " intersect.t34...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I11^Ichr1^I10^I20^I345.7^Iwhy?^I-" > exp
$BT intersect -a bed6.bed -b bed6.strand.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test for strand matches with BED3
##################################################################
echo " intersect.t35...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I-^Ichr1^I10^I20^I345.7^Iwhy?^I-" > exp
$BT intersect -a bed6.strand.bed -b bed6.strand2.bed -wa -wb -s | cat -t > obs
check obs exp
##################################################################
# Test for strand matches with BED3
##################################################################
echo " intersect.t36...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I-^Ichr1^I11^I21^I345.7^Iwhy?^I+" > exp
$BT intersect -a bed6.strand.bed -b bed6.strand2.bed -wa -wb -S | cat -t > obs
check obs exp
rm obs exp
##################################################################
# Test that intersect of bed query with BAM DB gives Bed output.
##################################################################
echo " intersect.t37...\c"
echo \
"chr1 10 20 a1 1 +
chr1 100 200 a2 2 -" > exp
$BT intersect -a a.bed -b a.bam > obs
check obs exp
rm obs exp
##################################################################
# Test that -split works on identical records even if
# -f 1 is ued (100% overlap)
##################################################################
echo " intersect.t38...\c"
echo \
"chr1 1 100 A 0 + 1 100 0 2 10,10 0,90 chr1 1 100 B 0 + 1 100 0 2 10,10 0,90 20" > exp
$BT intersect -wao -f 1 -split -a splitBug155_a.bed -b splitBug155_b.bed > obs
check obs exp
rm obs exp
##################################################################
# Test that fractional overlap must be greater than 0.0
##################################################################
echo " intersect.t39...\c"
echo \
"***** ERROR: -f must be in the range (0.0, 1.0]. *****" > exp
$BT intersect -a a.bed -b b.bed -f 0.0 2>&1 > /dev/null | cat - | head -2 | tail -1 > obs
check exp obs
rm exp obs
##################################################################
# Test that fractional overlap must be <= than 1.0
##################################################################
echo " intersect.t40...\c"
echo \
"***** ERROR: -f must be in the range (0.0, 1.0]. *****" > exp
$BT intersect -a a.bed -b b.bed -f 1.00001 2>&1 > /dev/null | cat - | head -2 | tail -1 > obs
check exp obs
rm exp obs
##################################################################
# bug167_strandSweep.bed
##################################################################
echo " intersect.t41...\c"
echo \
"22" > exp
$BT intersect -a bug167_strandSweep.bed -b bug167_strandSweep.bed -sorted -s -wa -wb | wc -l > obs
sed -i 's/^\s*//' obs
check exp obs
rm exp obs
##################################################################
# bug167_strandSweep.bed
##################################################################
echo " intersect.t42...\c"
echo \
"20" > exp
$BT intersect -a bug167_strandSweep.bed -b bug167_strandSweep.bed -sorted -S -wa -wb | wc -l > obs
sed -i 's/^\s*//' obs
check exp obs
rm exp obs
rm one_block.bam two_blocks.bam three_blocks.bam
##################################################################
# Bug 187 0 length records
##################################################################
echo " intersect.t43...\c"
echo \
"chr7 33059403 33059403 chr7 33059336 33060883 NT5C3A intron 0
chr7 33059403 33059403 chr7 32599076 33069221 NAq intron 0" > exp
$BT intersect -a bug187_a.bed -b bug187_b.bed -wao > obs
check exp obs
rm exp obs
##################################################################
# see that naming conventions are tested with unsorted data.
##################################################################
echo " intersect.t44...\c"
echo \
"***** WARNING: File nonamecheck_a.bed has a record where naming convention (leading zero) is inconsistent with other files:
chr1 10 20" > exp
$BT intersect -a nonamecheck_a.bed -b nonamecheck_b.bed 2>&1 > /dev/null | cat - | head -2 > obs
check exp obs
rm exp obs
##################################################################
# see that differently named chroms don't work with -sorted
##################################################################
echo " intersect.t45...\c"
echo \
"***** WARNING: File nonamecheck_b.bed has a record where naming convention (leading zero) is inconsistent with other files:
chr01 15 25" > exp
$BT intersect -a nonamecheck_a.bed -b nonamecheck_b.bed -sorted 2>&1 > /dev/null | cat - | head -2 > obs
check exp obs
rm exp obs
##################################################################
# see that differently named chroms -sorted and -nonamecheck
# don't complain with -nonamecheck
##################################################################
echo " intersect.t46...\c"
touch exp
$BT intersect -a nonamecheck_a.bed -b nonamecheck_b.bed -sorted -nonamecheck 2>&1 > /dev/null | cat - > obs
check exp obs
rm exp obs
##################################################################
# see that SVLEN in VCF files is treated as zero length
# records when the SV type is an insertion
##################################################################
echo " intersect.t47...\c"
echo \
"chr1 1 a G <DEL> 70.90
chr1 1 a G <DEL> 70.90
chr1 4 a G <INS> 70.90" > exp
$BT intersect -a bug223_sv1_a.vcf -b bug223_sv1_b.vcf | cut -f1-6 > obs
check exp obs
rm exp obs
##################################################################
# see that SVLEN in VCF files can handle multiple numbers,
# at end of line, followed by NULL.
##################################################################
echo " intersect.t48...\c"
echo \
"chr1 1 a G <DEL> 70.90
chr1 1 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90" > exp
$BT intersect -a bug223_d.vcf -b bug223_d.vcf | cut -f1-6 > obs
check exp obs
rm exp obs
##################################################################
# see that SVLEN in VCF files can handle multiple numbers,
# at end of line, followed by a tab
##################################################################
echo " intersect.t49...\c"
echo \
"chr1 1 a G <DEL> 70.90
chr1 1 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90" > exp
$BT intersect -a bug223_e.vcf -b bug223_e.vcf | cut -f1-6 > obs
check exp obs
rm exp obs
##################################################################
# see that SVLEN in VCF files can handle single numbers,
# at end of line, followed by null
##################################################################
echo " intersect.t50...\c"
echo \
"chr1 1 a G <DEL> 70.90
chr1 1 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90" > exp
$BT intersect -a bug223_f.vcf -b bug223_f.vcf | cut -f1-6 > obs
check exp obs
rm exp obs
##################################################################
# Bug 44: test that bgzipped vcf file works correctly
# with race condition
##################################################################
echo " intersect.t51...\c"
echo \
"MT 2706 . A G 2965 PASS BRF=0.05;FR=1;HP=1;HapScore=1;MGOF=17;MMLQ=30;MQ=62.05;NF=7607;NR=8147;PP=2965;QD=20;SC=AGGCGGGCATAACACAGCAAG;SbPval=0.52;Source=Platypus;TC=15840;TCF=7679;TCR=8161;TR=15754;WE=2749;WS=2693;CSQ=G|ENSG00000198763|ENST00000361453|Transcript|upstream_gene_variant||||||rs2854128|1764|1|MT-ND2|HGNC|7456|protein_coding|YES||ENSP00000355046|NU2M_HUMAN|Q7GXY9_HUMAN&Q5Q3P5_HUMAN&Q14X33_HUMAN&Q14WT3_HUMAN&A6ZH82_HUMAN&A6ZGN8_HUMAN&A6ZGG3_HUMAN|UPI0000000AA2||||||A:0.1656|||||||||||||,G|ENSG00000210151|ENST00000387416|Transcript|downstream_gene_variant||||||rs2854128|4740|-1|MT-TS1|HGNC|7497|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210077|ENST00000387342|Transcript|downstream_gene_variant||||||rs2854128|1036|1|MT-TV|HGNC|7500|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210144|ENST00000387409|Transcript|downstream_gene_variant||||||rs2854128|3120|-1|MT-TY|HGNC|7502|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210117|ENST00000387382|Transcript|upstream_gene_variant||||||rs2854128|2806|1|MT-TW|HGNC|7501|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210107|ENST00000387372|Transcript|downstream_gene_variant||||||rs2854128|1623|-1|MT-TQ|HGNC|7495|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210140|ENST00000387405|Transcript|downstream_gene_variant||||||rs2854128|3055|-1|MT-TC|HGNC|7477|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000211459|ENST00000389680|Transcript|downstream_gene_variant||||||rs2854128|1105|1|MT-RNR1|HGNC|7470|Mt_rRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210082|ENST00000387347|Transcript|non_coding_transcript_exon_variant&non_coding_transcript_variant|1036|||||rs2854128||1|MT-RNR2|HGNC|7471|Mt_rRNA|YES||||||||1/1|||A:0.1656|||||||||||||,G|ENSG00000210127|ENST00000387392|Transcript|downstream_gene_variant||||||rs2854128|2881|-1|MT-TA|HGNC|7475|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000198712|ENST00000361739|Transcript|upstream_gene_variant||||||rs2854128|4880|1|MT-CO2|HGNC|7421|protein_coding|YES||ENSP00000354876|COX2_HUMAN|Q7GXZ8_HUMAN&Q4R1L5_HUMAN&Q4R1L3_HUMAN&Q14XT3_HUMAN&K7WVJ5_HUMAN&H9E7W2_HUMAN&H9E7T7_HUMAN&H9E7P8_HUMAN&H9E7F7_HUMAN&E2DTL8_HUMAN&D3WYY9_HUMAN&D2Y6Y2_HUMAN&D2Y6Y1_HUMAN&B2YKU2_HUMAN|UPI0000000AA4||||||A:0.1656|||||||||||||,G|ENSG00000210049|ENST00000387314|Transcript|downstream_gene_variant||||||rs2854128|2059|1|MT-TF|HGNC|7481|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000198888|ENST00000361390|Transcript|upstream_gene_variant||||||rs2854128|601|1|MT-ND1|HGNC|7455|protein_coding|YES||ENSP00000354687|NU1M_HUMAN|Q85KV6_HUMAN&Q8WCX9_HUMAN&Q5Q757_HUMAN&Q14WI3_HUMAN&G3EBI1_HUMAN&D2Y6X8_HUMAN&D2Y6X6_HUMAN&A6ZHG8_HUMAN|UPI0000000AA1||||||A:0.1656|||||||||||||,G|ENSG00000209082|ENST00000386347|Transcript|upstream_gene_variant||||||rs2854128|524|1|MT-TL1|HGNC|7490|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000198804|ENST00000361624|Transcript|upstream_gene_variant||||||rs2854128|3198|1|MT-CO1|HGNC|7419|protein_coding|YES||ENSP00000354499|COX1_HUMAN|Q957U9_HUMAN&Q7GXY8_HUMAN&M9Z2G2_HUMAN&Q8HBX8_HUMAN&Q5Q1W2_HUMAN&Q4R1L4_HUMAN&Q14XD3_HUMAN&Q14X83_HUMAN&F8U4W0_HUMAN&D3WYY6_HUMAN&D3WYY5_HUMAN&D3WYY4_HUMAN&D2Y6W4_HUMAN&C8YAE4_HUMAN&C3UPN2_HUMAN&B7TCT8_HUMAN&B2Y9D8_HUMAN&A5YMT3_HUMAN&A1XP63_HUMAN&A0S1I7_HUMAN|UPI0000000AA3||||||A:0.1656|||||||||||||,G|ENSG00000210154|ENST00000387419|Transcript|upstream_gene_variant||||||rs2854128|4812|1|MT-TD|HGNC|7478|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210112|ENST00000387377|Transcript|upstream_gene_variant||||||rs2854128|1696|1|MT-TM|HGNC|7492|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210135|ENST00000387400|Transcript|downstream_gene_variant||||||rs2854128|2951|-1|MT-TN|HGNC|7493|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210100|ENST00000387365|Transcript|upstream_gene_variant||||||rs2854128|1557|1|MT-TI|HGNC|7488|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||;GR=3.07;PH=0.654;PS=0.002 GT:GL:GOF:GQ:NR:NV 1/1:-300,-298.01,0:3:99:2733:2718 1/1:-300,-298.01,0:17:99:6509:6461 1/1:-300,-298.01,0:2:99:6598:6575 MT 2591 2747 rRNA" > exp
$BT intersect -a bug44_a.vcf.gz -b bug44_b.bed -wa -wb > obs
check exp obs
rm exp obs
##################################################################
# Test basic -f functionality
##################################################################
echo " intersect.t52...\c"
echo "chr1 10 12 a1 1 +
chr2 10 12 a2 1 -" > exp
$BT intersect -a x.bed -b y.bed -f 0.2 > obs
check exp obs
rm exp obs
echo " intersect.t53...\c"
echo "\c" > exp
$BT intersect -a x.bed -b y.bed -f 0.21 > obs
check exp obs
rm exp obs
##################################################################
# Test basic -F functionality
##################################################################
echo " intersect.t54...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -F 0.21 -wa -wb > obs
check exp obs
rm exp obs
##################################################################
# Test basic -f with -F
##################################################################
echo " intersect.t55...\c"
echo "\c" > exp
$BT intersect -a x.bed -b y.bed -f 0.21 -F 0.21 -wa -wb > obs
check exp obs
rm exp obs
echo " intersect.t56...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -f 0.19 -F 0.21 -wa -wb > obs
check exp obs
rm exp obs
echo " intersect.t57...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -f 0.19 -F 0.21 -wa -wb > obs
check exp obs
rm exp obs
echo " intersect.t58...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -f 0.19 -F 0.50 -wa -wb > obs
check exp obs
rm exp obs
echo " intersect.t59...\c"
echo "\c" > exp
$BT intersect -a x.bed -b y.bed -f 0.19 -F 0.51 -wa -wb > obs
check exp obs
rm exp obs
##################################################################
# Test basic -f with -F with BAM
##################################################################
echo " intersect.t60...\c"
echo "\c" > exp
$BT intersect -a x.bam -b y.bed -f 0.21 -F 0.21 -wa -wb | samtools view - > obs
check exp obs
rm exp obs
echo " intersect.t61...\c"
echo "a1 0 chr1 11 255 10M * 0 0 * *
a2 16 chr2 11 255 10M * 0 0 * *" > exp
$BT intersect -a x.bam -b y.bed -f 0.19 -F 0.21 -wa -wb | samtools view - > obs
check exp obs
rm exp obs
echo " intersect.t62...\c"
echo "a1 0 chr1 11 255 10M * 0 0 * *
a2 16 chr2 11 255 10M * 0 0 * *" > exp
$BT intersect -a x.bam -b y.bed -f 0.19 -F 0.21 -wa -wb | samtools view - > obs
check exp obs
rm exp obs
echo " intersect.t63...\c"
echo "a1 0 chr1 11 255 10M * 0 0 * *
a2 16 chr2 11 255 10M * 0 0 * *" > exp
$BT intersect -a x.bam -b y.bed -f 0.19 -F 0.50 -wa -wb | samtools view - > obs
check exp obs
rm exp obs
echo " intersect.t64...\c"
echo "\c" > exp
$BT intersect -a x.bam -b y.bed -f 0.19 -F 0.51 -wa -wb | samtools view - > obs
check exp obs
rm exp obs
##################################################################
# Test basic -f with -F and -e
##################################################################
echo " intersect.t65...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -f 0.21 -F 0.21 -wa -wb -e > obs
check exp obs
rm exp obs
cd multi_intersect
bash test-multi_intersect.sh
cd ..
cd sortAndNaming
bash test-sort-and-naming.sh
cd ..
|