/usr/share/perl5/Bio/GMOD/SeqUtils.pm is in libchado-perl 1.23-5.
This file is owned by root:root, with mode 0o644.
The actual contents of the file can be viewed below.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 | =head1 NAME
GMOD::Chado::SeqUtils -- common sequence in/out/check methods for Chado DB
=head1 SYNOPSIS
=head1 SEE ALSO
GMOD Chado sequence scripts for init_db, load_newseq, dump_seq, list_db .
gmod_init_db.pl -- initialize a new database, adding organisms, intialize.sql,
ontology data sets.
gmod_load_newseq.pl -- add miscellaneous organism sequences, cDNA, EST,
microsatellites, etc. not located on genome. Optionally
generate PublicID for these.
gmod_dump_seq.pl -- output sequences selected by organism, publication (input file),
seq type.
gmod_list_db.pl -- show feature statistics for chado db: # per organism, per seq type,
per publication/infile, and checksum test for sequence duplications.
=head1 AUTHOR
Don Gilbert, Feb 2004.
=head1 METHODS
=cut
package GMOD::Chado::SeqUtils;
use strict;
# use lib('/bio/biodb/common/perl/lib','/bio/biodb/common/system-local/perl/lib'); # test
use GMOD::Chado::LoadDBI;
use vars qw(
@dbparts
%cvterm
%org_cache
$nullcontact
);
our $DEBUG;
use constant SequenceOntology => 'Sequence Ontology';
use constant IDCounter => 'PublicID:counter'; # dbIdCounter == # Db->name key
BEGIN {
$DEBUG= 0 unless defined $DEBUG;
@dbparts= qw(NAME HOST PORT USERNAME PASSWORD); #? get from Chado::LoadDBI ?
%cvterm = ();
%org_cache = ();
}
sub new {
my $that= shift;
my $class= ref($that) || $that;
my %fields = @_;
my $self = \%fields;
bless $self, $class;
$self->init();
return $self;
}
sub init {
my $self= shift;
$self->{readwrite}= 0 unless defined $self->{readwrite};
$self->{verbose}= 0 unless defined $self->{verbose};
$self->{dochecksum}= 0 unless defined $self->{dochecksum};
$self->{defline_species}= 1 unless defined $self->{defline_species};
# $self->{autocv}= 0 unless defined $self->{autocv};
}
=item openChadoDB( %params )
basically calls Chado::LoadDBI->init( %$dbvals )
and setReadWrite flag, inits some values from db
parameters:
verbose => 1/0
readwrite => 1/0, r/w, t/f
dbvalues => \%dbvalues from getDatabaseOpenParams
=cut
sub openChadoDB {
my $self = shift;
my %opts = @_;
$self->{$_}= $opts{$_} foreach (keys %opts);
die "openChadoDB: call with dbvalues => \%dbvalues from getDatabaseOpenParams"
unless (ref $self->{dbvalues});
GMOD::Chado::LoadDBI->init( %{$self->{dbvalues}} );
# some useful values for readwrite only ?
# ($nullpub) = Bio::Chado::CDBI::Pub->search( miniref => 'null' );
($nullcontact) = Bio::Chado::CDBI::Contact->search( name => 'null' );
$self->initAutoCvTable();
}
=item getDatabaseOpenParams()
Runtime checks for Bio::Chado::CDBI::LoadDBI values of
NAME HOST PORT USERNAME PASSWORD [from getDatabaseParamKeys()]
Checks %ENV for $GMOD_SERVICE_key, CHADO_DB_key, e.g.
FLYBASE_DB_NAME = flybase-chado1
FLYBASE_DB_PORT = 7404
-- fallback to CHADO if GMOD_SERVICE is not defined
CHADO_DB_NAME = chado-test
CHADO_DB_PORT = 7302
Returns hash with these values, suitable for call to @ARG GetOptions()
my %dbvals= getDatabaseOpenParams();
my $ok= GetOptions(
'dbname:s' => \$dbvals{NAME},
'name:s' => \$dbvals{NAME},
'host:s' => \$dbvals{HOST},
'port:s' => \$dbvals{PORT},
'username:s' => \$dbvals{USERNAME},
'password:s' => \$dbvals{PASSWORD},
@otherOpts,
);
=cut
sub getDatabaseParamKeys { my $self= shift; return @dbparts; }
sub getDatabaseOpenParams {
my $self= shift;
my %dbvals= map { $_ => '' } @dbparts;
## check %ENV - first service_db keys, default to chado_db = flybase, eugenes, daphnia, etc.
my @service_db= ('CHADO_DB'); # what service is calling us ?
unshift(@service_db, $ENV{'GMOD_SERVICE'}.'_DB') if (defined $ENV{'GMOD_SERVICE'});
unshift(@service_db, $ENV{'ARGOS_SERVICE'}.'_DB') if (defined $ENV{'ARGOS_SERVICE'});
foreach my $service_db (@service_db) {
foreach my $part (@dbparts) {
next if ($dbvals{$part});
my $v= $ENV{$service_db.'_'.uc($part)};
$dbvals{$part}= $v if ($v);
}
}
return %dbvals;
}
=item getSeqType($seqtype, $ontology)
return Bio::Chado::CDBI::Cvterm matching seqtype from ontology.
Supports use of SO seq types
=cut
sub getSeqType {
my ($self, $seqtype, $ontname)= @_;
my $type_id= undef;
my $sotype = undef;
$ontname = SequenceOntology unless($ontname);
return $cvterm{$seqtype} if ($cvterm{$seqtype});
my @sotype = Bio::Chado::CDBI::Cvterm->search( name => $seqtype )
|| Bio::Chado::CDBI::Cvterm->search_like( name => "%$seqtype%" );
unless(@sotype) {
print STDERR "Seq type=$seqtype not found. Please choose a type from $ontname";
return undef;
}
elsif (@sotype > 1) {
print STDERR "These terms from $ontname match '$seqtype'.\n";
print STDERR " ",$_->name,"\n" foreach (@sotype);
# allow user choice here..
print STDERR "Choose Sequence type? \n"; #? STDERR?
chomp( $seqtype = <STDIN> );
foreach my $sot (@sotype) {
if ($sot->name eq $seqtype) { $sotype= $sot; last; }
}
return undef unless($sotype);
}
else { $sotype= shift @sotype; }
$sotype = $sotype->first()
if defined( $sotype ) and $sotype->isa('Class::DBI::Iterator');
my ($socv) = Bio::Chado::CDBI::Cv->search( name => $ontname );
unless ($socv) {
print STDERR "Ontology $ontname is not loaded; using $seqtype";
$self->cache_cvterm($seqtype);
}
elsif( $sotype->cv_id == $socv->id) {
print "Using seq type=".$sotype->name." from $ontname\n" if $self->{verbose};
$cvterm{$seqtype}= $sotype;
}
else {
print STDERR "$seqtype is not listed in $ontname";
return undef;
}
return $cvterm{$seqtype};
}
sub initAutoCvTable {
my ( $self ) = @_;
($self->{autocv}) = Bio::Chado::CDBI::Cv->search( name => 'autocreated' );
if(!$self->{autocv} && $self->{readwrite}) {
($self->{autocv}) = Bio::Chado::CDBI::Cv->find_or_create( {
name => 'autocreated',
definition => "auto created by $0",
} );
}
}
=item cache_cvterm( $name [, $cv] )
Look for $name in Bio::Chado::CDBI::Cvterm.
If not found and readwrite, add to cvterm table, with cv->id (autocv default)
Store in hash for frequent reuse.
return Bio::Chado::CDBI::Cvterm
=cut
sub cache_cvterm {
my ( $self, $name, $cv ) = @_;
return unless $name;
$cv= $self->{autocv} unless($cv);
unless (defined $cvterm{$name}) {
my ($term) =
Bio::Chado::CDBI::Cvterm->search( name => $name )
|| Bio::Chado::CDBI::Cvterm->search( name => ucfirst($name) );
if ( $term ) {
$term = $term->first() if defined( $term ) and $term->isa('Class::DBI::Iterator');
}
elsif ($self->{readwrite} && $cv) {
$term = Bio::Chado::CDBI::Cvterm->find_or_create( {
name => $name,
cv_id => $cv->id,
definition => "auto created by $0",
} ) ;
warn "unable to create a '$name' entry in the cvterm table"
unless($term);
}
$cvterm{$name} = $term;
}
return $cvterm{$name};
}
=item getOrganism( $organism, $quiet)
return Bio::Chado::CDBI::Organism matching common name, abbreviation (best) or genus.
Prompts for choice if ! $quiet
=cut
sub getOrganism {
my ($self, $organism, $quiet)= @_;
return undef unless($organism);
my $chadorg= $org_cache{$organism};
return $chadorg if $chadorg;
my $iter = Bio::Chado::CDBI::Organism->search( common_name => lc($organism) )
|| Bio::Chado::CDBI::Organism->search( abbreviation => ucfirst($organism) )
|| Bio::Chado::CDBI::Organism->search( genus => $organism );
if ($iter) {
if ( $iter->count == 1 ) { #? || quiet
$chadorg = $iter->first();
} elsif (!$quiet) {
print STDERR "The organism '$organism' matches these:\n";
for (my $org = $iter->first; ($org) ; $org= $iter->next) {
print STDERR " ".$org->genus." ".$org->species."/".$org->abbreviation."/".$org->common_name."\n";
}
print STDERR "Select organism? (abbreviation): \n";
chomp( $organism = <STDIN> );
for (my $org = $iter->first; ($org) ; $org= $iter->next) {
if ($org->abbreviation() eq $organism) { $chadorg= $org; last; }
}
}
}
else {
print STDERR "The organism '$organism' could not be found.\n";
unless($quiet) {
print STDERR "Available organisms:\n";
$iter = Bio::Chado::CDBI::Organism->retrieve_all;
for (my $org = $iter->first; ($org) ; $org= $iter->next) {
print STDERR " ".$org->genus." ".$org->species."/".$org->abbreviation."/".$org->common_name."\n";
}
print STDERR "Select organism? (abbreviation): \n";
chomp( $organism = <STDIN> );
for (my $org = $iter->first; ($org) ; $org= $iter->next) {
if ($org->abbreviation() eq $organism) { $chadorg= $org; last; }
}
}
}
if ($chadorg) {
$org_cache{$organism}= $chadorg;
print "Working with ".$chadorg->genus." ".$chadorg->species.".\n";
}
return $chadorg;
}
=pod
=item getSynonyms($chado_feature)
fetch synonym values, returns (wantarray) ? list : first
=cut
sub getSynonyms {
my ($self, $chado_feature) = @_;
my @ftsyn = Bio::Chado::CDBI::Feature_Synonym->search(
feature_id => $chado_feature->id,
# pub_id => $pub->id,
);
if (wantarray) {
my @names= ();
push @names, $_->synonym->name() foreach (@ftsyn);
return @names;
}
else {
return (@ftsyn) ? $ftsyn[0]->synonym->name() : undef;
}
}
=pod
=item getPubFeatures($pub)
return features given $pub->id (OUTFILE reference)
=cut
sub getPubFeatures {
my ($self, $pub) = @_;
my @allfeats= ();
my @fpub = Bio::Chado::CDBI::Feature_Pub->search(
pub_id => $pub->id,
{ order_by=>'feature_id' },
);
# print "getPubFeatures ".$pub->id." n= ".scalar(@fpub)."\n" if $self->{verbose};
push @allfeats, $_->feature_id foreach (@fpub);
return @allfeats;
}
=pod
=item getFeaturePubs($feat)
return pubs given $feat->feature_id
=cut
sub getFeaturePubs {
my ($self, $ft) = @_;
my @items= ();
my @fpub = Bio::Chado::CDBI::Feature_Pub->search(
feature_id => $ft->id,
{ order_by=>'pub_id' },
);
push @items, $_->pub_id foreach (@fpub);
return @items;
}
=item getDbxrefs($chado_feature)
@dbxrefs is array of DbName:DbAccession
=cut
sub getDbxrefs {
my ($self, $chado_feature) = @_;
my @dbxrefs= ();
my @feature_dbxref = Bio::Chado::CDBI::Feature_Dbxref->search(
feature_id => $chado_feature->id,
);
foreach my $d (@feature_dbxref) {
next unless $d->dbxref_id;
my $acc= $d->dbxref_id->accession;
my $db = $d->dbxref_id->db_id->name; ## cache this one
push(@dbxrefs, "$db:$acc");
}
return @dbxrefs;
}
=pod
=item getProperties($chado_feature)
get property values from the featureprop table.
%props is hash of property name => value
-- need bag, not hash - many vals per name
=cut
sub getProperties {
my ($self, $chado_feature) = @_;
my %props= ();
my @featureprop = Bio::Chado::CDBI::Featureprop->search(
feature_id => $chado_feature->id,
);
foreach my $p (@featureprop) {
next unless $p->type_id;
my $tpid= $p->type_id;
my $tpname= $self->{type_id}{$tpid};
unless($tpname) { $self->{type_id}{$tpid}= $tpname= $tpid->name; }
#my $tpname= $p->type_id->name;
$props{$tpname} .= "," if ($props{$tpname});
$props{$tpname} .= $p->value;
}
return %props;
}
=item dumpSequences($outh, @chado_features)
Write sequences to $outh from Bio::Chado::CDBI::Features.
Includes seq_type, synonyms, feature_properties, feature_dbxrefs on defline
Only fasta dump now. E.g.
>WFcd0000100 len=567;type=cDNA_clone;synonym=P1-E62000FW40325,WFBid100;contact=JColbo
urne;library=CGBvntr;date=Jan2004;taxon=D.pulicaria;clone=P1-E62000FW40325;strain=Mar
ieLake,Oregon
GCGGGAGNCCGGTATATTGCAGAGTGGCATTATGGCCGNGAAGCAGTNGT
ATCAACGCANAGTGGCCATTATGGCCGGGAAGCAGTGGTATCAACGCACG
## this is SLOW for 15K seq-feature database ...
.. use iterator, not @feaure array ..
.. cache common values ..
=cut
sub dumpSequences {
my ($self, $outh, $chado_features)= @_;
my $i = 0;
# print "dumpSequences n= ".scalar(@chado_features)."\n" if $self->{verbose};
if (!defined($chado_features)) {
warn "Need Bio::Chado::CDBI::Feature param";
return -1;
}
elsif ($chado_features->isa('Class::DBI::Iterator')) {
for (my $ft = $chado_features->first; ($ft) ; $ft= $chado_features->next) {
my $res = $ft->residues;
my $defline= $self->getFeatureDefline($ft);
print $outh $defline,"\n";
$res =~ s/(.{1,50})/$1\n/g;
print $outh $res,"\n";
$i++;
}
return $i;
}
my @fts=();
if (ref $chado_features =~ /ARRAY/) {
@fts= @$chado_features;
}
elsif ($chado_features->isa('Bio::Chado::CDBI::Feature')) {
@fts= ($chado_features);
}
foreach my $ft (@fts) {
my $res = $ft->residues;
my $defline= $self->getFeatureDefline($ft);
print $outh $defline,"\n";
$res =~ s/(.{1,50})/$1\n/g;
print $outh $res,"\n";
$i++;
}
return $i;
}
=item getFeatureDefline($chado_feature)
return basic >fasta string of chado_feature information
=cut
sub getFeatureDefline {
my ($self, $chado_feature)= @_;
#should we bother w/ Bio::Seq construction -> SeqIO::writeseq(seq); ?
my $name= $chado_feature->name;
my $len = $chado_feature->seqlen;
my $defline= ">$name len=$len";
my $tpid= $chado_feature->type_id;
my $tpname= $self->{type_id}{$tpid};
unless($tpname) { $self->{type_id}{$tpid}= $tpname= $tpid->name; }
$defline .= "; type=" . $tpname; ## $tpid->name $ cache this
my @synonyms= $self->getSynonyms($chado_feature);
$defline .= "; synonym=".join(",",@synonyms) if @synonyms;
my %props= $self->getProperties($chado_feature);
if ($self->{defline_species}) {
#?? always/sometimes add species=$org->genus." ".$org->species;
my $org= $chado_feature->organism_id;
# my $ospp= $org->species;
# my $species= $org->genus." ".$org->species;
my $ospp= $self->{spponly}{$org};
unless($ospp) { $self->{spponly}{$org}= $ospp= $org->species; }
my $species= $self->{species}{$org};
unless($species) { $self->{species}{$org}= $species= $org->genus." ".$org->species; }
foreach (qw(taxon species organism)) {
my $spp= $props{$_};
if ($spp && $spp =~ /$ospp/i) { delete $props{$_}; } #what - do both?; ignore this?
}
$defline .= "; species=".$species;
}
$defline .= "; ".join("; ", (map{ "$_=$props{$_}"} sort keys %props))
if %props;
my @dbxrefs= $self->getDbxrefs($chado_feature);
$defline .= "; dbxref=".join(",",@dbxrefs) if @dbxrefs;
if ($self->{dochecksum}) { # only if really want
my $check= $chado_feature->md5checksum; ## add if not 0
$defline .= "; checksum=$check" if ($check);
}
return $defline;
}
#? *defline = &getFeatureDefline;
=item lastPublicId($idtag, [$lastid])
Get [Set] last public id number for given idtag
=cut
sub lastPublicId {
my($self, $idtag, $idclass, $lastid)= @_;
my ($iddb) = Bio::Chado::CDBI::Db->search( name => IDCounter ); # $dbIdCounter
if (!$iddb && $self->{readwrite}) {
($iddb) = Bio::Chado::CDBI::Db->find_or_create( {
name => IDCounter,
description => "database id counters created by $0",
contact_id => $nullcontact, #??
# urlprefix => $idtag, #?
# url => $url,
} ) ;
$iddb->dbi_commit if $iddb;
}
#? save idbx
my ($idbx) = Bio::Chado::CDBI::Dbxref->search( accession => $idtag , db_id => $iddb->id);
$idbx = $idbx->first()
if defined($idbx) and $idbx->isa('Class::DBI::Iterator');
if($idbx) {
if (defined $lastid && $self->{readwrite}) {
$idbx->version($lastid);
$idbx->update(); $idbx->dbi_commit();
print "Put last id for $idtag = $lastid\n" if ($self->{verbose});
}
else {
$lastid= $idbx->version();
print "Get last id for $idtag = $lastid\n" if ($self->{verbose});
}
} else {
$lastid= 0;
if ( $self->{readwrite} ) {
$idbx= Bio::Chado::CDBI::Dbxref->find_or_create( {
accession => $idtag,
version => $lastid, # our data !
db_id => $iddb->id,
description => "id counter for $idclass by $0",
} );
$idbx->dbi_commit if $idbx;
print "New last id for $idtag = $lastid\n" if ($self->{verbose});
}
}
return $lastid;
}
=item listPublicIds($outhandle)
list public id counters
=cut
sub listPublicIds {
my ($self, $outhandle)= @_;
print $outhandle "\nPublic ID counter\n";
print $outhandle join("\t",qw(ID_Tag Last_ID Description)),"\n";
my ($iddb) = Bio::Chado::CDBI::Db->search( name => IDCounter );
if ($iddb) {
my $iter = Bio::Chado::CDBI::Dbxref->search( db_id => $iddb->id);
for (my $idbx= $iter->first(); ($idbx); $idbx= $iter->next()) {
my $idtag = $idbx->accession();
my $lastid= $idbx->version();
my $desc = $idbx->description();
print $outhandle join("\t", $idtag, $lastid, $desc),"\n";
}
}
print $outhandle "-"x60,"\n\n";
}
=item listDupChecksums( $outhandle, [$feature_iterator])
checks thru features md5checksum for duplicates and lists any
if feature_iterator is null, checks all Bio::Chado::CDBI::Feature
=cut
sub listDupChecksums {
my ($self, $outhandle, $iter)= @_;
print $outhandle "\nDuplicate checksums\n";
print $outhandle
join("\t",qw(Name____ Length Seq_type Synonym Feat_id Publication Checksum)),"\n";
my %checks=();
$iter = Bio::Chado::CDBI::Feature->retrieve_all unless($iter);
for (my $fit = $iter->first; ($fit) ; $fit= $iter->next) {
my $ck= $fit->md5checksum;
next unless($ck);
$checks{$ck}++;
}
foreach my $ck (keys %checks) {
next unless ($checks{$ck}>1);
$iter= Bio::Chado::CDBI::Feature->search( md5checksum => $ck );
for (my $fit = $iter->first; ($fit) ; $fit= $iter->next) {
my $syn= $self->getSynonyms($fit);
my @pub= $self->getFeaturePubs($fit);
my $pub= (@pub ? "'".$pub[0]->title()."'" : '');
print $outhandle join("\t", $fit->name, $fit->seqlen,
$fit->type_id->name, $syn, $fit->feature_id, $pub, $ck),
"\n";
}
}
print $outhandle "-"x60,"\n\n";
}
1;
|